Description :
From Genome Similarity Track
Location :
Scaffold_16:1818- 6419
Transcript NameFunction/comments
g18045.t1hypothetical protein

Sequence
4601 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCACGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGGGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTTGATCGAACCTCGTAATCGGTTCTCTCCCCTTCCACGCCACTTGTT
TTTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAATTGCCCTCCTTCTTCCTA
AGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCG
TCTAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTGG
AATTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGC
TGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCCTCATCCGTTGCTAGCGTCACGTCAGGACGATCAGAAAAAACCTTCACGGCCTTAAG
CTTCGAAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCG
TGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGCGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGT
CGTTGTGGCGATCGGCTCTCGCTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCT
GCGCGGGTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTCT
CCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAG
CGCGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGC
GCGGAAGAAATCAGACATAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGG
TCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACGAGAAGCTCCGTGTTGCCCTTGAACGATTTTGGCAG
AGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCG
CAATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGGCCCCGCCAGTGAAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGT
GCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGCAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATCG
GGCGGTGTTTACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCATAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGCAGTCAAGGCTGCT
GCGTCGCCCCGCAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTCGTACTAACTTCTCACTCCTCATGCGTTGGACGATCTCTTCTT
GCATAGCTGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAG
GCGGTTGATCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGA
TTCCAATCGCGCTTCACATGAAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGGTCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAAT
CGATTTCACCACGCATCTGTCGGATGATCAGGTTGGAATCTCCACAGATCACAACTCGTCCTCTGTTCTGATCGGACAGTAACTTGAAGCCTAGCAGCAG
TCCGCGATATTCGGCTTCGTTGACAGTCAGATCATCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATAC
GCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAGCTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTT
TGGGCTCTTTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTT
CAAGCACTTCCTGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGAATTCAGCAACCAGGCGAGCGTC
GAGTACCTCGACAGCACCTTGATCGATCGGTTGGTCAGGAGCGTGTAACACACATCCAAAATCCGAAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGT
AATTCAATTCGTTCGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTT
GGCGTAGACCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGATCGAACGCCGTCCTCGCT
CTAGTCCACCGATCATCGGACTCCGTTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAAAAGTCCACTTCTCGCAGTTCGTATAAGATCGCAGCGT
AAACGGCGAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGA
TTCCAGATCTTTCGGATTGGCTTCCAAACCTTCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTAACCACGCTGATC
GACAGATTCCATCGCTCGCAAGCGTCAGCAATGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCG
CCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGACTTATCCGGAGGTAT
CCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGA
ACGCGGAGATCTTTCGCGCACGTTCCGTCATTGAGACCACTAGCCATATCCAAAGAGCAGTATCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGA
TCAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTAATGATGATCAC
GATCGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCAACC
CGCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGCGGGAGGGCGTTCCCTTTACCGATCAGCA
AGTGTCGTCGTCGCCAGATGATCTGGCGAAGTCGATCGATCTCTTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTC
GGTAGTGGTCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGA
G