Description :
From Genome Similarity Track
Location :
Scaffold_2564:1818- 4168
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2564-snap-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
2350 bases(100 bases per row)
TCGTTCGAGTCCTCGAAGGCGTCGTCACCGTCAGCCTCGTTCTCATCCGCCTCAGCAGCGACGGCGTTCTCCTGCTGGATCGTGTACAAGTTACGGTAGA
CGCCGTCTTGGGGCTCCATGAGCTCCTCGTGGCGGCCTTGCTCCACAACGGACCCATTCGACACGACGACGATGTTGTCGGCGTTGCGCACAGTACTGAG
GCGATGGGCGATCACGAGCGTCGTCATCTGGGTTGTCGCCATGAGGTCGTTGAGCGCAGCTTGCACGACGCGCTCGCTCTCGGTGTCCAGTGCACTCGTG
GCCTCGTCCAGCACGAGGATCTTTGGCTCACGGACCAGCGCCCGCGCGATCGCGACGCGCTGCTTTTGTCCACCAGAGAGCGACACGCCCTTCTCGCCTA
CGAGGGTCTCGTACTTCTCAGGTAGTGCCATGATGAAGTCGTGCGCATTCGCGAGCTTGGCCGCGGCCACGACCTGCTCGTGGGAGTACGCGCCGCCGTC
TGGGGACACGGCGATGTTGTCAAACACGCTCGAGGCGAAGAGCACGGGCTCCTGGGACACGAGCCCGATTTGCGCGCGGAGCCACTTGACGTTGAGCGTC
TTGACGTCGCGGCCGNNNNNNNNNNGAGCGTTGGCTCCTGGCCCACCATGCCGATCTGAGCGCGCAGCCAGTTGACGTTGAGCGTCTTGGTGTCCACGCC
GTCGAGCAGCACGAGGCCTCGGCTGGGGTCGTAGAAGCGCTCGAGCAGCGCAATGAGCGTGCTCTTGCCACCGCCGCTGGGGCCCACGAAGGCCACTTTT
TGGCCCGCGGCGATTCTGACCGAGTAGCTGCTCAGGATTCGCGCCTCGGGCCGACTCGGGTACGCGAAATCAAGGTTCTCCGCATCGATGGCACCCATGC
AGCGCTCCGGAATCAAGCCGTCGCTGGATGCCGCGTTGATCGCCGAGGGTGTGTCGAGGATCTCAAAGAGTGCCGCGGCCGAGCCCCTGGCCTCCGCCAC
AGCCGAGAGGCTGGGTGAGATCTGACCCAGCGAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCCACAAGCTGCCCGTATAGAAGCCGTTGATGACCGCGGCGCGTCGGTAGAACGCGATGTTCTCGCGCTCGACGGTCTCGGTCTTGGCG
TTGAACTTGGCGATCGCGCGCTTCTCGCTGTTCAGCGACGCGACTGTGCGCATGGCCGCCAGCGTTTCCTCGGCGACGGCACCGGCCTCGGCGTAGAGCT
GCTGGGATCGCTGCGCACGCGTGCGCATTGCACCGAGCAAGATGGACATGGTGACCGCCATCACGGGCGTGACGCAGCACATGACGAGCGCAATGTCCCA
GCCTTTGACAAAGGCGATGGCGTACCCGCCAACGAACTGGCCGGTGAACTTGACGGCCTCGCCGAGCTTGACGCCCATGCCCGTCTTGATCTTTAGTGTG
TCGCCCGTGATGCGGCTCGTGAGCTGCATCGCGTCGTGGCTGTCGTACCACGCGATGTCCAGGTGCAGCAGGTGGCGCAGTGTGTGCTCGCGAAGCGCCT
TCATCTGGCGCTCGGCCGAGTTGGCGAAGAGTGCGAACGCGAGAAAGTCCGTGACGAAGAGAGCGACGGCGATGAGCAGGTACTCGAGCGCCGCGCGGTT
AACGACGGACTTGTCAAAGGGCGCGAACGCCGAGATCGCGTTGCCAAACACGAGCGCCATGCACGGGTAGAGTCCACCGTTGATCGCCGCCATCACCACG
CCGATCGTGAGCGTCGCGATGTCACGTGGGGTCGCAAACCGGTAGAGTGACAAGAAGGATGGAGCCTTGGTGGAGTTCTTGGTGGGCTGCTGGGCGGCGT
CGTCGCTGCTGGCTCGCAGCGTGTCCACCGCGGACTGCTCCTTCTTGAGTGGACGCTGCCGGGCGATCTCGAGCGACACGAGCGACGGGCGCGGCGTGAG
CACCTGCGCGAAGAACTGCTGTCTGTCGGACGGCTGGTCCTCCAGCTCCGTCTTGTTGGCCATCGTGTGGCTGTCCGGTGGTCAAGATGAATTGGCCAAT
GGTGCTGGGGTCTGGGAGCTGCAGAGCAAATGCGAGAGTGAGGCCATGGA