Description :
From Genome Similarity Track
Location :
Scaffold_358:18177- 21184
Sequence
3007 bases(100 bases per row)
TTTTTTGCGCAAACATGTCGTGTGATGAACGTCATTGTCGGCGCTCCAGTCACAGTTTGCTATGTCCTTAAATCAAAAGATGTGAGTGAGTAAGTAAAGC
CATCATATCGAACCAGAGCAAGCAACGATCAGCATCACTGATGCAATAAATTCGTTAGAATTTGCGAAGATGATGCGGCCGTTGCATGAGGGTGGGTCAC
AATGCACAATGGTGTGGAAGTCCAATCGAACCAACACCTACAGAACTTAATGGAACCAATAAATTTGACTGCATTCCTCAGTACAAGCCTATTAACTTTG
TAGGCACTATCAATCGCGCATTACTGATATAGACCCTTACTTACACGAGCATGTAGTTCCTCGGCTTTATTGGCAGAACAGCAACTGGATTGTCGTAAAA
CAGAATCTCAATTGTTGCGTTGCCTTAACATATTCGTGATAACAGGGGCATCCGTTTTAGCTACGCATGCGCGCATTTCAAAAGCCCCCTGTGCACGGCC
ATCTTTCTGTCCTGCTGCGTATTCTTATGCGGACCTACGTTGCACATTAACAGATCCGGAACAGCACAGGAAAATAGAAATCTAAACAGTAACTAACAGG
ACAAATAATTATAACACGCGTTACGTGCACGCGACACGAACGATCCGAATACGCTCCAAAATGAATAATAAAGAAAGAAGCAGTCTTACCACTCACTACC
GCAGAAACCTTTACATGTAAGCGTGATGGGGATTCCTTGCTGTTGTAGGGGCGTCTACCTTTAAAATGTAATGAGCGATTGAGCGCATCTGCGGACGTAA
AAGCCTCGAGTCCATAAACGTTTCAGGCAAATCTTGACAGAATCTTGCACTAAAGAACACATAAGAACGATTGCGAACTATACTGAATTAGGTCAAATAG
ATGTGCAAAAACCGGTTATAGTGATATAATCTCAAGGTATGTCGATAAATTAGCCAATCATGTAGCGTTATATCAAACTGAGGGAATTTTACCAGAAAAC
TGAGGGGAGATTAACGACTCCCTTGACAATACCCTATTTCATTATCTCTGTCTTGGAAAGGCGTCATATTCTAATTATGTGTTTTCAGGGGAACCTTAAA
AGAGCAAGTGACTCACTTAAAAACAAGTACTCCCTAGAAAGACAACTGCATAGCCTAAAAACATGGTCTGCAGCGTGTACTTGTATTTCACTTCTATAGA
TAGGAAATGATTAAGTAATGTACGTTAAGAAACAGAAACAAATATTAATAGGGAGCGTATGATAAGCCTTCAGTTTTTGCTGATGAGCCTTCACCGCATA
TATTAAACAAGTAATTGGATTTAACGGCCTCTATGGTGAAATTGTATCGGTGTAGTTCTTAGAAGTAACGTGAAGTCTTCATTCATCTCATTTCGCCTAC
TGTATCGTATCTACGGGCGTGTGACAACGCAGCGTATCGAGAGAGCGCATGCTGCGGTTGTCAAGAAGTGTTTGGATGTAGCTACAGATAAGCAGCATTA
TGTCGGTCTTGATGATCTTGTTTTTTGGCTACTTAATAATTGTTTTGCCCTTAGGCGATCTATAATTGATGAGCACAGCTCTCGGCTTTGCTTGCCACGG
CAACCTTCATACTGTCAGCCATCAAAACGCAAGGGAATGCGCCATCATCGAGATGCAGCTAGAATATCTGCTTGCGACAGTAATGGGCAAGACTTCCGTC
GCAAGTGTACTGTAAGTCCATCATCTTCAACGTCTTTAGAGACTTGAGCCAGAACCTTCTCAAAATCTGATGACAAATAACATGGGCCACTCTTGTTGTC
ATGTAGCTATCATATTACGAAGGCCATGGACAGTAGAGGATTTTGACTAGTATTGGTGGCTGGTCCAACCTCCAGGACGAAGGGCTGACACCGAACCAGT
CACATATGATTCTGTCGATTACAATGCTTTCATGAAAGGACTTAATGAGAGGTATGTTATTACTGATAGACATCAGCAAAGGACGCTATATGATCATGCT
ATCGCTGATCCAGCTGCTGCCATCCGTGAAACAGCGCTAATATGGACGCGCGGACTCCCAACAGGTTATACCCGCCGCAATTTAGCTCACTTTGGTCATC
TAGAATATGAATTGAATCCTACGCGACGTCCACGATGTGGCTGCTGTGAACAACGAGAGCACAAAGCAAATACTGGTCATCGAGTAGAACAAGTACAAGC
AGCGACTGCAGCACCTTTATCAGTGCGACCGATCGATGATATCACGCTGTTCGATCCTTTAGACGATGCTGTCAATGCTATTTTGAACATCGAACTGTTG
ATGTCGATATTCGTTGACAACATGTAGCTTAAGTGTACTTAGATGTCATCACTACATAATGAAACTTCCTTGAACCACACAGAAATCGACGCACACAACT
CGAATGGCTCTCCTACTACCTCTTGCAGCTGTCCACGACAAGCAGTTCAGTCAGGCGGGTGTGTAGCAATTTAGCGCAACTAGAGGGTGTGTAGCATAAA
AGATGGAGCTTCCTTTGACCACTTTGAGGTAATCAAATCCAATCACTTATTTAATATATGGTGTGAAGACTCATTAGCGAAAACTGAAGGTTCATTATCC
GCTTCCAATAAACATATAAAAGGGTAAATCAAGGCCGGGTTAAGTAAAAGAGTTAATTCGTGAAGAGCCGCAGCCTATACCGCATGCATCAAATGCATCT
TGTGCTCTTTGGTTTTGTATTTAAATCAAAAGGCAGGTTTCGTACCGTACACGCTGCACTATAGCCGTATCATATCCATCATTGTCTCAGGCTGGAAGAG
TATGTGTGTGAAACGGTTGTGTTCGTCGAGTTTGACAGTTGAAGAAATGGTTAGAGTTGCGACTTCTCTATTATATTTCGATTGCGGTCAATCCATGGCG
TCATTTCTGCTTCTACCTGTGGATAATCTTATCCATTTCCATTCTGATGATCGAGGATGTCTTCCCGAAGGGATTTTTGGGTTAAAATCCGGGAAGCGCC
GACAACG