Description :
From Genome Similarity Track
Location :
Scaffold_33:181757- 182975
Transcript NameFunction/comments
Hyaar_Emoy2804925transmembrane protein, putative

Sequence
1218 bases(100 bases per row)
CCAACACCGTCGGTGGCGTGCTAGAACAAGTGTGGCAAATCGATGTCGGTGTCGCAATTGCGCTCCTGTACAACTTTGTCGTCTTTGCCTGTGTGCCCCT
CAAGCAAGGCAATCTCTTGACGGTGTCCCAGAATCTCAATGGTAGTACGTACTACGTGAGTCTGCAAGACTGGGGCGTCACTCTTCCATTGCTTGCCCTT
TTCACCCTGGTAGTGCTGCTCTTGCCTATTGTAAGACCACTTTCCTGTGTACCGAGTACTATATTACTTTTGTTTTCTCTGTTGTTGACATTGTGTGTGG
TGACTATCAACTTATGGACTAACGGGATTGTTGGTTGTTGTGCTGTAAATGCTCCTAGCAACCGAACGTGAAGAAGTTTGCTGTGGGTACAAATTTGTAT
TTCAGTACGTTCTCGATAGTCATCACTCGAAACGGAACGGAGATACAAAGCTAATTGTGATAATGTTTGGTTATGAATTATGTGTGTGTGTGTGTATTTG
GTATGGGTGTGGTTGCAGCGTTGACACTCGTTAACCCCATGAATCCGATATTCACGGCCTTGCTCAAAGATAGCACAGACGGGAACAGCTACTATGGCAC
GAAGAATCTGCTTAAACAGTTGGCCATTTACAGCGCAGTTGGCGTCGCGGGCACCTTCATTTCACTTGCGACGATGATGCTTCCCTTCCCGATCTTGTAC
GTCGGATAGCAGCACCAGCATGTGTTTTTTTACCGGGAGCGTCGCTTGGCTGATACAATGGACGCTTGCTATTGCCATACTCTTGTGTTAGTGCGATGCA
GAAGCTGCGGCGACACATGGCAGCATCGCCCCACGATATCCGAGATATACTGAACTTGATTGTCGACTCGTACTGCTTTCGTGCAAAGGATATAAAGAAG
ATGGACTTCTTTAAGCTGCGACTTGATCGGCTACTGGAAAATGCGCACGAGCGTCTCACGACAATGGAGTCACTGCTAAGTGACTGCTGGTGGGAAGAGC
TTGTGGGGTTTGGCGTCTGCTTCCATTTCAACAAGACCATCGCTAAGCAGCTTGTGAGGTTGTACGCGAAACTCCTTACAGACTTGCACGCAATGAAATT
TGCCATCGAGGCGGAGACTTGCCACTGGACGCATGTCGTGCTGCTCAAGAAGTTACAGACACGATTCTACGTGCTACAGGTTGAAGCAAATGATCTGCTT
GAGGACATCTCGCTCGAG