Description :
From Genome Similarity Track
Location :
contig_7:181746- 182835
Transcript NameFunction/comments
g2013.t1hypothetical protein L916_00379

Sequence
1089 bases(100 bases per row)
GTAGGTAAAAGTTGATTAACTTTAGCTGGACTTACGTCTTGCAGACCTATGCTATTACTAGTGTCTTACGTCTAGCATCGCGGAGTCCATATTCGTTGTC
GTGGGAGGTTAGGAAGAAGTGCAGTCTGTTCTGACACGAATCCCAAGCGCGTAAGCACTCGATTAAGCGCTCCGCCGTCAATATTCCAATCAGATGAATG
CCGAAACAGGAAATGGCAGTGGCTTCGAAATGAAGCCTGCAAGTTAGCGACATTTGGCGTCACCGCTTGTGTTTCGCCGAAGTAAATGTCATTGCGCAGC
CGCCACGTTGCGTGAAACACTATAGCAGTGTGCATTCTCCACAGTAGCAACAGGTTCTCCTGATCGCCTCTCCATCCTCTAGCAACATCTCTGTTGGATG
GGAACAGCAGAAGCTTCCACTCCAAGGTGCTTCGAAAAGCCCTTCGCCATTGACTCCACAATATTTGCCACATTTGCGTTAGCGCCGGACAAGTGAGAAA
ACAATGTTCCAATGTTTCAATTGAATCGCAGCCGTCCCGGACACAAAGTTGTGCATTCGGATTGCTAGTAAGCATGAAGAAGAGCCTTGATCCGACAATG
AGGTCTCCAAAGAATAGCCTTAGCATTAAATCGTGAACGACAGGTACCAGACACCGTCGAAGCCAAAGTACCTGAGTAAGCGTTTGATGTACACGCCCTC
GGGGACATCCAAGTTGTATCATTGGGTGTTGCTCCAATTCGTCGAGAGGCTGGATGAGTTTCTTCCAGTCTCTGGCTTTTAGGCCAGGAAAGAACCGTGA
TCGTGATCCTTCAGGAGTGCTTGCAGTCACCACCACCCCTAGAGATGGAGGTGTTGTATTGCTAACCGCCCTTCGCAACCCACCCGCTTCCGGGTGAGGA
AGAACCCGCTGATAAATACTTCGCATTTGATAGTAGAGTACGAAAATATCGCGGAGCAATATGCGTGAACCCAGCTCGGGTTCCACGATGGAACAAACCA
TTTCGAAAAACTCCCCTGAACTTAGCCAGTGGCGATCATTATCCAGAAAATCAGCAAGGCAATGCTTGTTTGCCTTCGCGAGAGCCCGA