Description :
From Genome Similarity Track
Location :
Scaffold_356:18172- 20030
Sequence
1858 bases(100 bases per row)
ATAGTATGTCTCGGTTGCTTCCGTATTGCAATCGCGATCAACATTTCATCCATATCTTCCCGCGGTGTACTACTAGCTGCGAGGGTGCCGTGGGTTTCTT
CATCCCCTTTGTTTCACTGACAAATCTCCAGCGTTTAAGTCGACCGTAAAGCTGCCGATCTACCAAGTCGTCCATTGAGACTTGACGACTGCACCAACCA
ATCTAAGGTGGAATATCTCGTGAGAACCTTGACATTCCGAGAGCCCAATAGCGTATAACAAATATTTAAAATCCGTAGCAGGGCCAGAACTTCCTTCTCT
ATCGCTCCATAATTGACTTCATTTGGTTTTAACGTGCGACTTGGGAACATAACAGGCCAATTCACTCCATCATGTTCCTGTAGCATAGCTGCGAATACCG
CCCATTTGCTAGCTTAAACCACGATCACTGGTCGGCGGTCTGGATCAAAATGTCTGAGCACCTGGATTTGGGCTACTTTAGCCTTCGACATGGTAAACGC
AATCATGGACTTCTCCCAACGATGACTACCAGTATGTTCTCCATCGGACTCTTTCACTTTAGTTGGATCCTGACCATTCGTTGTCACCAGCTGATAAACG
TGATCACATGTGGGCCACTTCCCGCGGTCGTCATTAATCTAAGTACTACGGACGTGATCATAGCTGGATGAACATTCATTCTCCGTGGTGTGCGAACGCC
TGATCTTATGAAAATTAGCTTCCCTCAATTCTTTCAAGACCGAGGCGTATATGGCGAAGTCTTCAATGAACCAGCTGTAATATTTCAGGATTCCTAGGAA
GGACTGCATTGACAGCAGTGTCTTGGGAAAAGGAATATTCATTAACGACCCCAGATCCTTCGGGTCAGCTTTGATTCCTTTTATTAATACTTGGTGCTCG
AGGTACTCAACTTTGTTTCGTCCCCAGAAGCTCTTAGGTAGGCTGATCGATAAATTTTAACTGATCACATACGTCCAACGATCTTTTCACGTTTTAATAG
AGAGACGTCCAGGATAACGCTGGGATTATAATGTGATCAATGTAGGACCTTCGTCCTAGAACCGAAGGATTTCGGTGCGGGTTTGGCTCGCCTTTTGTAA
ACACATCGACCAGTTGAGACACCCCGTGGTCACTTGACTTCTGCCGATCCCCGATCATAAGATATCCATATAATGCGTTATTTACCATACGTTGATATAT
CTGAGGCGCGTTCCTCAGCCCGAATAGCATGCGTAATCATTCATACAGACCTGAGAGCGTGATAAAAGCAGAGATCATTCATGCTCTTTCCGTTATCTTC
ACAATCCTAAATCCGCTGGCCATATCCAATGAACATTAACAATAGCGCTCTGTCCAGATCCTGCAACAAATCGTTGATCAAGGGCATGGGGTATATCATC
AGCCTCGTTAATTGGTTCACTCTTCAGTAGTCTATACACAGTCGTATATCCATCCCATTCTTTTCATAATCACTACGATCGGCGACGCCCATGGTGAAGT
TGAGAAACAAATGATTTTGGCCGATAGTGACCCTTTGATCAGGTCCGCCAACATTTCACGGAACTTTGGGGCTACTGGTTTTACTCGTTGTGCGACTGGG
GATGCTTCTCCGACATCTATATCACAAATTACACCTCGCGCAGCGGGTAAGAGGGCATTTCCTTTACCCATCAGAAGGTGTCGTTTCTTCCAGATCATCT
GACTCAATTCCTCTTGCTGCTTGGTCAATGGGACCCCTGGGTCGCCTACCTGTATGTCGTCAATTTTTACCTCGCTCAGCATCACATCTACTTCCGGTAA
GACTGCCATGTGTTGGCCAAAATCTTACGCAAACAACACTCCAGTTTTGTGGTAGTAT