Description :
From Genome Similarity Track
Location :
Scaffold_356:18172- 20029
Sequence
1857 bases(100 bases per row)
ATAGTATGTCTCGGTTGCTTCCGTATTGCAATCGCGATCAACATTTCATCCATATCTTCCCGCGGTGTACTACTAGCTGCGAGGGTGCCGTGGGTTTCTT
CATCCCCTTTGTTTCACTGACAAATCTCCAGCGTTTAAGTCGACCGTAAAGCTGCCGATCTACCAAGTCGTCCATTGAGACTTGACGACTGCACCAACCA
ATCTAAGGTGGAATATCTCGTGAGAACCTTGACATTCCGAGAGCCCAATAGCGTATAACAAATATTTAAAATCCGTAGCAGGGCCAGAACTTCCTTCTCT
ATCGCTCCATAATTGACTTCATTTGGTTTTAACGTGCGACTTGGGAACATAACAGGCCAATTCACTCCATCATGTTCCTGTAGCATAGCTGCGAATACCG
CCCATTTGCTAGCTTAAACCACGATCACTGGTCGGCGGTCTGGATCAAAATGTCTGAGCACCTGGATTTGGGCTACTTTAGCCTTCGACATGGTAAACGC
AATCATGGACTTCTCCCAACGATGACTACCAGTATGTTCTCCATCGGACTCTTTCACTTTAGTTGGATCCTGACCATTCGTTGTCACCAGCTGATAAACG
TGATCACATGTGGGCCACTTCCCGCGGTCGTCATTAATCTAAGTACTACGGACGTGATCATAGCTGGATGAACATTCATTCTCCGTGGTGTGCGAACGCC
TGATCTTATGAAAATTAGCTTCCCTCAATTCTTTCAAGACCGAGGCGTATATGGCGAAGTCTTCAATGAACCAGCTGTAATATTTCAGGATTCCTAGGAA
GGACTGCATTGACAGCAGTGTCTTGGGAAAAGGAATATTCATTAACGACCCCAGATCCTTCGGGTCAGCTTTGATTCCTTTTATTAATACTTGGTGCTCG
AGGTACTCAACTTTGTTTCGTCCCCAGAAGCTCTTAGGTAGGCTGATCGATAAATTTTAACTGATCACATACGTCCAACGATCTTTTCACGTTTTAATAG
AGAGACGTCCAGGATAACGCTGGGATTATAATGTGATCAATGTAGGACCTTCGTCCTAGAACCGAAGGATTTCGGTGCGGGTTTGGCTCGCCTTTTGTAA
ACACATCGACCAGTTGAGACACCCCGTGGTCACTTGACTTCTGCCGATCCCCGATCATAAGATATCCATATAATGCGTTATTTACCATACGTTGATATAT
CTGAGGCGCGTTCCTCAGCCCGAATAGCATGCGTAATCATTCATACAGACCTGAGAGCGTGATAAAAGCAGAGATCATTCATGCTCTTTCCGTTATCTTC
ACAATCCTAAATCCGCTGGCCATATCCAATGAACATTAACAATAGCGCTCTGTCCAGATCCTGCAACAAATCGTTGATCAAGGGCATGGGGTATATCATC
AGCCTCGTTAATTGGTTCACTCTTCAGTAGTCTATACACAGTCGTATATCCATCCCATTCTTTTCATAATCACTACGATCGGCGACGCCCATGGTGAAGT
TGAGAAACAAATGATTTTGGCCGATAGTGACCCTTTGATCAGGTCCGCCAACATTTCACGGAACTTTGGGGCTACTGGTTTTACTCGTTGTGCGACTGGG
GATGCTTCTCCGACATCTATATCACAAATTACACCTCGCGCAGCGGGTAAGAGGGCATTTCCTTTACCCATCAGAAGGTGTCGTTTCTTCCAGATCATCT
GACTCAATTCCTCTTGCTGCTTGGTCAATGGGACCCCTGGGTCGCCTACCTGTATGTCGTCAATTTTTACCTCGCTCAGCATCACATCTACTTCCGGTAA
GACTGCCATGTGTTGGCCAAAATCTTACGCAAACAACACTCCAGTTTTGTGGTAGTA