Description :
From Genome Similarity Track
Location :
Scaffold_524:1817- 16238
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_524-abinit-gene-0.31ATP-binding cassette sub-family F member 2
Pytap_DAOMBR444maker-pag1_scaffold_524-snap-gene-0.14Serine/threonine-protein phosphatase
Pytap_DAOMBR444maker-pag1_scaffold_524-snap-gene-0.15Cullin-associated NEDD8-dissociated protein
Pytap_DAOMBR444maker-pag1_scaffold_524-snap-gene-0.10Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_524-snap-gene-0.11EML5 (ISS)

Sequence
14421 bases(100 bases per row)
CGACAATGAATCGGATATTCGGGCGCAAGAAGCCGGAACTGCCCAACGTGAACATCTCCGATGTGAACGCTAAGGTTgACGGGCGCGTCACGGACCTGGA
TATGAAGATCAGCAAGCTCGACGAAGAGCTGCGCAAATACCGCGTGCAGGTGAGGAGGAAGGCCGTCATGGTTGGTGGTACGAAGCACTTGCTGTATGAT
TGACTAGAGAGCtGTTTTTTTtCATAGATGTCAAAGACCAAAGGCCCTGCGCTGAATGGTATCAAGCAGCGCGCAATGCAGACGCTAAAGCGCAAGAAGA
TGTACGAAGCCCAGCGTGACAACCTCACGGCCCAGTCATTCAATCTGGAACAGGTATGTCAACAACCATCGCaTGGGAAAGTAGTAGACGCGTGTATGAC
GGAGATTGCACTGTTGATACCATCAGGCGAGCTTTGCCGTCGAGTCGTCACGCGATACGATCTCGACAGTCGCCGCAATGAAGAGCGCAGCGACACAACT
CAAAaTTGAAACCAAGAAAATTGACCTTAATGAGCTCGAGGTAGCTGTCTTGCCCATTtGTGTGTGGGcTCCCTGTGCGACGGATTGACGCGTATGGCGC
TTGATATCAGGATATTCAAGATGATATGGCTGATCTGCTCGAGGACATGAATGAAATCCAGGAGATCATGGGACGGTCGTATGGGTGCGCAACACATGCA
TGTAGCTATCACTGTGTTGTTCTGATGCACACTGTACAACACTTGTTTTGTAGCATTGGAGCTGACATTGACGAAAGTGAGCTGGAGGCTGAGCTTGAAG
GACTTGAGGAAGAATGGGCAGAAGAGGAGGCCGCAGCCACCACGACCGAGGCCACACCATCGTACCTCGCACCTACGCACGATCTCCCTGCTGCTCCCTC
GAGCATCCTTCCAGACCGTACGCCAGCGCGTCGTACAGACGAGTTCGGGCTACCAGTCGGTCCCTCACCGGCCATGTGACCTCAATGCAGGACGGGCCGT
TTCTCCATGGGCTCAGATTCCAACGATCTCGCGTCTGAGAAAAACGCACCCATGTGTTGACTTATGCGCCAATCAAAAGGCGTTTCCTCTCGATCCACAG
GTATACGTTTTCACCGGTCCTGTCTGCATGATGTACCTATATGAGACGCGGCTCTGTGTCACCGTGCTGTTCGATCGGGTATACGGTTTTAGAGGTCGCA
CCTGGTTGGCTCTTGGTTGGTGGGGAGCGCCAACGGAAGCGGCACTGGCGTCAGCATCCGGCACCAGAGTGAGATCGCCCCCCCAAGGACCAAGATGGCG
CCACGCGTGAAGAaGGAGCGCGGCGAGAAGCGCACGAGTAAGAAGGACGCGCGCAAGGCCGCCGCCGATGAGAAGAaGAAGGCCGAGAGCGCCGCCGCGC
TGGAGAACATGTCGCTCGCTGACCGCCTCGCCGAGGAAGGCATCATCACGACTTGCGCACAGAGCGCCCGCAGCGTGCACAAGAATTtCAAGGACATCAA
CGTCGCGAGCTTCACGCTGCTCTtCCACGGCAAGGTgCTGCTGGACGACACAGACATCTCGCTCAaCTATGGCCGTCGCTACGGTCTCATtGGTCGCAAC
GGCTCGGGTAAgaCGACGTTCATGAACGTGCTCGGTGCGCGTGGTGTGCCgATCCCcGAcTCGATCGATaTCTACcACcTCAAGCACGAGATCGAAGCCA
GTGACATGACGGCGCTCGAGGCCGTGCTGTCGGTCGACGAGGAGCGCAACAAGCTCCAGGCCGAGGCCGATGAGCTCTCGGAGCAGATGCTTGATGAGTC
GCTGAGCGAGGAGAACTCGCAGGCGATCTCGGACCGGCTTACGGACATTTACGAGCGCCTTGAAGAGATGGACGCTGATACGGCTGAGCTTCGCGCGCGC
TCGATCCTGTCGGGTCTGACGTTCTCGGACGAGATGATGCAGAAGAAGACGCGTGACTTCTCCGGTGgTTGGCGTATGCGTATCGCGCTTGCCCGTGCGC
TGTTCATTCAGCCAACGCTCTTGCTGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
TTGATATGGAGGCCGTCGTGTGGCTTGAGGACTACCTGTCCAaGTGGAAGAAGATTCTGCTCATGATTTCGCACTCGCAGGAGTTCATGAACGAAGTCTG
CACCAACATTATCGACCTTACGCAGAAGAAGCTCGAGTACTACACGGGTAACTACGACATGTACGTCAAGACCAAGGCCGAAAAGGAGGAGAACCAGATG
AAGCGGTACCAGTGGGAGCAGGACCAGATCAAGCACATGAAGGAGTACATTGCGCGTTTCGGTCACGGTAGCGCCAAGCTCGCCCGTCAGGCGCAGAGTA
AGGAGAAGACGCTTGCCAAGATGGTGCGTGAAGGTCTCACGGAGAAGGTCGTGAGCGAAGCCGTGGGCGATTTCAAGTTCCCAGACCCCGAGCGTCTCCC
TCCTCCAGTGCTCATGTTCCAGAACGTTTCGTTCGGTTACCCAGGCTCGCCCCTCCTGTACTCGGGTGTTGAGCTCGGTCTGGATCTTGACTCGCGTGTG
GCTCTTGTTGGTGCCAACGGTACGGGTAAGACGACGCTGCTCAAGCTCATCACTGGTGACCTCGTCCCAGTCAACGGCAACGTGCGACCACACAGCAAGC
TCCGTGTGGCCCGCTTCAGCCAGCACTTCGTCGACGTACTCGACCTGACGCAGTGCCCACTCGACTACTTCCGCTCGCTCTTCCCAACCAAGTCGGTGGA
AGATGTGCGTAGCTACCTCGGTCGCTACGGTATCTCGGGTGAGGTCCAGACGCAGATCATGGGCCAGCTCTCGGATGGTCAGAAGTCGCGTGTCGTCTTC
GCCTACATGGCCCAGCAGAACGCGCACATGCTTCTGCTTGATGAACCGACGAACCACTTGGACATGGAGTCGATCGATGCTCTTGCGCGTGCCATCAACA
ACTTTAAGGGTGGTATGCTCCTAGTCAGTCACGACATGCGATTGATCTCGCAGGTGGCCAAGGAGATTTGGCTCGTCGAAGACCAGAAGATCCGCGTGTA
CGAGGGCGAGATCTCGGACTTCAAGATGCGTGTGCGTAAGCAGCTCAAGCTTGCGGATAAGCCTGCAAAGGTTGAAGAGTAAGCGTTCCGATTTCCGAAT
TTCCCCCcGATATGTTGATGAATATAGACAAACACCAAAGGCCATCATTGTTGAGATCTCAGTCGTCCTCGGACTGATTGTTATCATCGTGGACCGCGCT
CAAGCGGATGCTTCGTCGACGTACAGCTACCAAAGGTGCGTCGTTGCTGCCTCTCTGCCGAGAGCGTGGCGAGTCTTCATCGTCTGTGGAATCAGACTCG
TCCTGCGACGCCCGTTGCTGTCGAGACGGAGAGGAAACAGCAGGCGATGCGGAAACTACAATTGATCCTGAACGGCGTCTTTGGACAGGAGAGACCAAGG
GAACTGCCATCCGGTCGTCGGTGGGACTCGCTGCAGTGGCTGAACCGTGTACTACACCATTGACTGCGAAGTTCTCAGCATGTACTCGATCACCGGGTGC
TGGAGCGGGTGCTGGACGCGGTGGAGACTGCAGGCTCGTGATGCTACGTCGCCTCCGCACAATTTGCTGTTGACCTGCCGAGCGGTTAATGGGAATGATC
CGATCTCGGTCTACGAGCACACACCCGCAGGACGCATCGTCACCGAGTCCGTGATCCTTCGAAGTTGAAAAGATCGTGAGCACGCGAGCGCTCTTGGCGA
CACTCACGCCGTCAATCGTGGCTTCGTGGGCTCGGAGGATGTAGCTGAGTCGATGGGAGTGCAGGAAGTCGTCGATGGCTTTCGAGCCGAAGCACACGGC
GTTGCCTCCACGCTGCACGCTTTTACCGAAGCCTGTGGTTGGGTCCAGCGCTGCCTCATGCTCTTCCTTGGCTGGGTCCGCCCACAACATATCACTGACC
ATCCGAAGTGCTGGGTTCGCGTCGTAGAAGCGCTTGTCCAGGATGTCCATCGGTGCTGTGGTCGGCAGTCGTCGGATGGACTCGAGCAGCGTCATGCCAT
CGACAGCACCAACAGAAAGAGGACGTGGGATGCCACCGTGGACGCAGAAAaCCGAGCTATCGATCGTAGCCACCAACGGCAGGCGATCGAATGCGTGGTT
GATCTGGTGCCACACGATGTATCCTTCATCACGCCCGAAGCGCTGGCGACACTGCGTCAGGAAGCTGCCGCTGCCGTAGTAGTTCTCGAGGCCATTTACT
GCGCGAGTTTCGTGGTTGCCACGCAGTAAAAAGACCTTCTTCGGGTTCAGCAGCTTGTGTGCGAATAGGTAGGCAACACACTCGAGCGAGGAGAGCCCAC
GGTCGACGTAGTCACCGAGGAAAAGGAACGTGCCAGCGGTGAGACCGAAGCCGAAGCGCCACAAGTGCGACGAGAAGAACGACAGATCCGAGAGGTTGCC
GTGGACATCGCCGAAGACGTACACTGGACTCTCTAACGACAGGCATCGTGCCTCGGACTCGAACAGCGCGCTGGCCTGGGCACTGAGCTCGACAAGGTCG
GCACCGAACTGGATCGAGTGAAGGTAGGGCAGCGAAAGCgTGGGGTTCAGAAACGCAGCTGCCATGCGTTCAGCGAGGGCCGGGGCAGGGGCCATCGGCG
TGGCGTGAAGCTCGGCGATCGCTTGGACGGACTTGAGACTCGCGTGGCGGTCCAACCGCGCTGTCTGGATGCTGCCTTGCTCCGTGATCGAGTGGAGCCA
TGGCACCAGGCGGGGGGCGTTGTTGTCTGGGGTGCGGGAAGCCGCCTCCTTCATTACGCTCTGCCGTGATGCCAGTGATGCAAGCTGGCCTTTAAGGAAC
GCGACCTCATTGTCCTTCTCTATGCGCATCACTTGCAGCGCCTCTTTCAGACGCTGCACCTCGAGACGCAGCTGCCTGTACGGACTCGCATGGGTGGCGT
CCCCGCAGCTACTCGAGGACGCGCAGTCCTGCTTTGAGTGTGCATGCTGATCGAAGCCCATAACGCGATGCTCACGATCGGGGCTCGAGGCCATCGCGTC
GCGCAGCTGCAGCGCTAGCGGAGTGGCGCTGGCAGTCGGCaGCATCCCGTCGCGTTCGTTCTGTTGGTGGTCGGCAAGCGCTACCACAACGCTCATCGTG
TTCCCGACACCGTCTCTCGGGACGTGCGTCAGCGATACAAATGTGTACTGCGGTCTACGTGTCTGTAAGGACCACGCATGCGCTCTGATGACGCAGATGC
CATGCTCAAGATAGCTGTCGGTCCCTCTTCATTTTGGGGCGCGATCTTTCCGAGAATACCGGCGAAaGGTCACTTTAACAGTTTCGGATTGGCTAATAAT
GTCATCCAAGTAGTTTGATTGGCTGAAAATACTCGCGCCCGTCCGTCACGCGATCAGATGCACTCTGCTGAACATGGCGCGCACCCGCGAGTGTACGGCG
CCAGTGAGCGCATGCGTCGCCCTTCGGACCTTGCTGTGGGCGGCACTACTCTCTACTTCGGTTGTAGCGCTAGAGAAGCGCAAAGCGATTGACTGGGACG
CGCTTGAGAAGGCGTGGGCAGCAGATGATGACGTGCGAGAGCTCCGGTCCGACGCGGACGAGCAGGTCGAACGACTCAGCCAAGCGTGCGTAGGGTGAGA
GGAAGCGCGAAGGGCAGTGTAACTAACGACACGTCGCTGAACGAGAGCAGGCCCGAGTCCGATGCGAAGCTATTGGGGCCgCAAATGATCTTCGTGACGC
TGAAGACGCAAGAATCGCTCGACACAGTCGCGTCAAGATGGAAACAAGTACGTGCTGCTAGTGCCTGTCAGTATGTGGAAGACAAACGAAGTGATCACGC
TGGTGGTGGTTAGATGCTATGGAACGGCGGTGTGGATGTCAATGTATACGAAATCGACGCGAACAAGGTGCTGATTGGTCTCCAAAAGGGTGACTACATG
CGGGATCTGCGCCTGTTCTTGAAAGAGCAGACGGAAGTTGTTGAGTATGAGTGGAACaGCAAGACCTTCTCACGAGCAGACCCtGTGCCAGAAGAACGGA
GAGGAATGAACAAGAGAAGCACCAAGAAAGGGCAGAAAACCCGAAGTAAAACGAAGAAGAAGAAGGTCTCCACGAAGGAGCACTCCCTTAAAAACCACCG
CGCATCGACGGACACAAACCACGAGTTGTAGGGAGAGAAAAGCTTCGTACTACCCACGTTCACTCTTGTTCGTTTACTCGCTCTTGACCTCGTCCAACAT
TCTCGAGAGCATCGCATTCTTCTTGATGCTCTCGTGGAACGCATGGAACTTTGGGTGAGTGTCCGTGTCACGCACCTTACTCAGACCATCGACGGCTCGC
AACGCACTGCGGATCAGATCCTTCGTGCGCTCGACCTCAGTACCGACTTGGTCTTCCTTCACCTTCTTGTTCGTCGTCTTCTCGAGCGGCTCAATAATCA
AGTCGAGTGAACCGACGATGGCACCTGGCTTCAGAGTGCAAATCTTGACGAGAATTTGATGACACAGCATCTGCACATCGTCCTGATCCTTTAGGCCCAG
CTGAAGGTATGGGAAGAGCGCGCCAATGTCAAGGTGTTGAGGCAGCACGTCCATGAGGGTATCCGcACAAGCGTACGCAGCCTTGCGCAGAGGAAGACCA
TCGTCAACCTTGTGCTTAAATGGACCGAGGTCAACAACTCTTTCGAGTTTAACCTCAGTGGCCTTGAGAAGCACAGGGAAGAGTTGTtCCTtAGTATGTG
gtGCAAGGAaCGATGCCTGGTGATGAGCCGTCGTGTTGAGAGCGAGCAGTGCAGCTCGACGAaCGTTGAGGTCTTCATCCTCAAGCGCCTTAACAAACGG
CGTGATATCCGAGAAAAGTGGCGCAACTGCAGCTTTGTTCTTCGTAGACCCAGCAGCAGTCACGGCGCTCTTGATGCTCGTGACTCCTGTCCATCGGGAG
TGAGCCGAAGAagAAACCGTCAGCTCCAGAACAACTGGGACAAGCTTTGACGAGTCTGTGACAGCCAGCCTTCCAACACACGCAGCGACCAGGTTTCGAA
CACCTTCCTCTTCACGATCGCTCAGCTGCTTTAGCACTGGAAGAACACGATCAACATAGGCCGAGAACCCATCATCGATGCTCGTTCCGTGGTGAGCAAT
GACTTCACGAAGTGCCGTCAAGAGAAGATATGAATTCTCTCCCTGCTCCAATCCCTTCACAATTGTTTCCAGGTACTCCGCCTTGTTGCCAACACAGATA
CTTCCGAGAGCATATGCCGCCGCTGACTTCACCTCCTCAGCCGACGACTTGAAGTTCTCCAGAATAACAGGCTTGACATCAGAGAAGCCGCCATCGGCCA
ATGAAATGACTCGCCCAAACTCGCCTAGACAGTACAGTGCGAGTACACGGTTCTTCTCAGACGTAGGTTGTTGAATTTCACTGACGAACTTCGAAAACGC
TTGCTGACGCTCATCTGCAGATGCGGCAAAGCAGACTGCAGCGATACAACGGGCCACGTTAACAGTCGCCTGGCGGGTGAGTTCGGACCCTTGGTTCGTC
AAGGATGTGAACAGAGATTCAAAGCCACATAACTGGGTCAGCTGACCGAAGAACGACTTGAGGGTCTCAAGGGTACTGCCTTGGACCATGGCGCTCTGTG
CCAAAGCCAGCACGTTGTTTGCCACACTTTGTTGCACAGCAGGTGTCGTCGCCACACTTGGAGCAGCCTTCAACACGTTCGAgATCAGCGTAATACCCAT
ACGGCAAAGCTGAAGATCACTGTCCACAAGTAACGCTGAAGCATCCGACACAACCTCTGCAAGCAATTCGGGCTTCAACGACTTTCCTTGATGAACGACA
AGATCGTTAAGTGCATCAAGGGTCGCTTGCTTGAGCGTTCGGGATTGCTGACGAAGAAGCTGAGACAAAGCACCAGTTGCATCCTCGAGGATTGGAGTCA
AGTTAACATTCAAAGGTGAGCGCGCAATTGTCGCAATCGCCTTCATACTTTGCACCCGAGTGATCTCGTTGTTGAGGCGATCCATgaGCAAAGGTAGAAC
CTCATTGACACGGTCACCCAGTTCATCGCCTACACGAGCGACGAGCTGGCCAACACAGCAGATCACAGCTTCCTTGATTtCTtGATCGATGTCGTTTGCC
TTGAGACTCGGTAGGACACCATCGAACAGCGGCACAGCATACTTTTTCGCGTTGGTGGCATCGCCGCTGACATCAGGGCGAATCACATGAACCAAAGATT
CGATGAGTCCCAATGCCTTCGCGACAGTCTTGTACCAGTCACCTCTCACAGCCTTCAGAGATACATCCACCAAAGATTGCAGGTGCTTGTTGAGAGGAGT
GGCGTCGTGAGAGTCAATCAGGAGACGCAGGTACACCATCGTCTCCAACTTCAAGTCGGAATGCTTGTCTTCGGCGGCGCGTACAAGGTTTGGCATGAGA
GCATCTACGAACTCGCCAAGTTGACCCCGcAAGACGAGGGTGagCTCAGTCAGCAAAGCCAGCACGGCACAGCGaGATGCAACCGACGCTTTTGGGCCAA
ATTGCTTGTTAGCAGCGACGACCACTGCCTTGGTACGCTGCTTCAGCTGGTCAAGACACGTCTGGATCGCGTGCGACGGTGGGTGACCATCtGTTGGCAA
TGCTCGACGAGTAGCACCGAGGAGTTCCGCGAAAACAGTAAATACATCGATACGAACATTCTCCTCACGCTCCTTGAATCGAGAGATGAGCAATGGGCTC
GCAGTAGTGTAGAGATGCTCAAGCAGGTCCTCGCGGGAGGTGATCAGCGCAGCAAGAACACGAAGAGCAGCTCGACGAACCTTCCAGCTCGTGTCATCGT
CGTCACTGTAGTCGCCGTCGTCATCAACATCGCTATACTCCTCTTCCTCGTCATCCATTGGCTCATCATCTTCCTCATCAGTCTCACCGTAGTTATAGTT
CGGGTCGTACTTGCTAAAGACGACCACTAGCTTCAGAATTCGCTCAATATGTGGCGTGATACCGTTGTGGCATCGAACAACGAAGCTCTCAAACGCCTGG
AAGCAGTTCTCTCGCTGCTCATCCGACGATTCATTTTGCATTCCTTCGTCTTCTGGGTCGCCGCAGAAGTCCGCCAGGATCGGGATGATGGCGTCGAGGT
GTTTACCGAGACGATGGCCAGCAGAGCGAGAGAGCGTGCCGACAGTTTGGATCAGCGTACGCTTGTCGTTCGAATCCTTCTTGGTCTGAATTCCACGAAT
GAGATGTTCCACAAGGCGAGTAAGTAGCGCGTCCGACGCCATCACGCCGAGGGAACCGACGCATGCTGTCGCTCGCTTGCGCACCAAAGGCGATGCATCC
GTGAGCTGCACGATAACCAAGTTCATAATCtGTTCATGCTCGGTGGCGCATGCATGGCCAAaGCGACGAAGCAGGTCCGTGAGGATATCCAGCGTCTCGG
CCTTGACTGCCGTCTCAGCATCCTTCGCGATACCCGAAGCAAGACGCTCACAGAGACTGGTGGCGACGAGTGCGCCGGTCTTCGGCGACACATCGGCCAG
AATGGTCTTGAGGCCGATAGCGTAAATGTCGCGCAGCTCGGGCTTGCCGTGCAGAATCAACTCACTCAGCTTCTTGCAAATGTCGGCCACTTGCGCGTCC
TGCACCTTGGTCACCAAGATTCCCAGACTACAATCCCCAAGAACGCCATGAGTCCGCCCTACCACTTCAATCCACTTGCGTGAGATGTACCCACCACTTG
ACGGCAATGGACTGCACGTCGTTCGACTTGTCATCGAGTTGCTTCAGCACCGCAGCGCACACCCTACACGCACCTCCCCTTCAGTCGCTGTTGTATTTCG
TCAGCTCCTTCTCCCTCCCACTCACTTGGACTCGAGGAACGCGCCGAGCTCGACGTTGTTGTTGAGCTCGTTGCAGAGGTCGGACGTGGCCATATAACGC
TCATCCTTATCGTAGTCGGTGGTCTGTGACAGCGCAGTTCAGTGCCCGATGGTCCTCCCGCTCTCCCTCCCGTGGATGGACACGCACCTTGTCCAGCAGC
AGCGCGATGCGCTCCTCGTGGCCGGGCATCTTCGGTCGCTTTCCTCTCTCTTTCCTCAAGAGAGAATGGACCCAGCACCTTGGATCTAGGGTGCCTTCTT
ACGTGGTCCACCTTACTTCGACTGGGTTGACCGTTTAACTGACCTCATTGGAGTGACTTCAATATGGTCACTAATGGACGTTTCAGTTCCGGTCGGCTAT
TCCGAGAAGCCTGTGGGGgAATACTGGGAGTCGTGTGAACGGGAAGGCTCGGCGCTGCAATGAGTATGGTGGACATGGGCAAGGAGGAAGACAGCAACTG
ATGTGTGGTGCAGGTGATCCGCAAGACAAGGAGCTCGAGTATGAGCAGCTGACGGACCTTGTGGCCGGAGAAATCGACCGGCAACTCAAGCACCGAAGCG
ATGTGCTCGACACGATGAAGtCGCAGaTGTCCAAAGTCCTCAAAGAGTTTGAAGATCTCACATGGAATGTGCAAGCCAAACGGTCATGGATGAAGAGCAT
TGGgAAAACTCGTGAGATCATGCCTACGAGTCCcAGTGCCGTTGCGATCCATCCAGTTGTTACAACGGGGAACATCGTATCTGGTCCAGTTCCATTGCCA
TCGAAACTACCGAAGtCGGTTTGGCCGCTTGTTAGACAGCGCTgAGGGCAGAAtATTTGACACAAGAGCTTGtAGGTTGAGTGGATTGAAGGCTAGGAAC
AAGTTGCAAGGGAAACTCAACCGTAATATCAGTGGCACGCTCCCACCGACCGATGGGGTTACTTCAGACGCCAGAAACCAAGACGGGAAAATCGCATTTG
GTAGGTCGGTAGCATCTTCTGTATGTATCGCCATGTACTCACATACCTTTGTAGACAAAAAACTACCACGTGTCGCTAACATTGAGAGGCGACCCGACGG
AATCCAATCCATGCTTGCGATGCAGCAAAAGCAAACGATGTATGAAAAAGCATCCGCGCGATATCCACAATGCCGATCAAATATTTATGCTCCAAGTCTG
TATGATTTGAATGAGTCGAGTTGGCTGTCACAGGCTCCTCAGCCTGCTCCCCGAACGACGCTTGAGCTGGAATTTGTGTATGGAGTAAACAATGGATCAT
CTTCAACAAGCACAATGACaCAAAGCAGTGCTGTATCCAGCTCAACCACGAACATATCTGGCAACGTGCACTGTCTGAACACGGGTGAAATAATGTGGTT
CACGGCAACACTTGTTGTTCTCTACTCGAAAGAGACGAACTCACAACGATACTTCCAGGAACACACCAATCAAGTGACGAGTATTGCTCTTCATCCGAAC
CAGCATATAGTTGCTTCAGGACAAGTCGGACGCGACACATTTGTGCTTGTGTGGGATGCAAACGACGATGTATTGGGAAAACGATTCGCGTGTTTAAAAG
GTCACACCGTTTCAGTTCGATCCATCTGCTTTTCGCATGACGGCAAGCTCGTTGCATCACTGGGTGGGGATATGTACAACACGATCTGCATCCACGATTG
GCGGGATCAGACTTTGTTGGTAAGTGCCCGTGGTCACAGCTTCCGAGTTCACACCATTGCTTTCAACCCGTTTCAAGCGTATGGACGACCTGAGACAAAA
CGAGCCAAGCGTCCTGGTCAAGCACTGCACGATGACGAGGTTTGCTATACTCTGGTGAGCTGTGGAGTCCGACATATTCGCTTCTGGACTTTGACCAGGA
CCGAATACTCGCCACCTCCCCACGAAGAAAGTGAGCAAAGTGCGTTCTACGGCTCGtCCTTCGGGAGTCCCGTTCGATTACGCCCACCGACTCCGCATGA
GAAAATGTGGAAGCTTGAAGGCAATGTGCCTTCGTTTCATGGCAGACTTGACGTTCAAGATTTCACGAGTTTGGgTTTTGTGGATGACTCTCCACCACTC
TACGTGTACGATGAGAGTAGGAAAGAACTAGTCGCAACCAATTCAAACGATCACACACTCGGCCGTGTTATTGCCGGCACAGCAAAGGGAGACCTTtGTG
tGTTTTGGCAGCCGAGAAAAGCCCCTGAAATGGGTGATACTCCACAGCAAAATCATCtCAAAGAGCCTGCGAAGTGGTGGGAGATTCCGGATGAGTATAC
CGATGCTGATATCAACGAACTCGTACTTGAAAAGACTGCGTATGAATCAAGTGGTAGACTTGTGGATCTTGTTCCTCACGAcGTTGAGACGGGTAATCGA
TTCAAGATATCAAAACAAGCCCAGCTCGAGATTGACAGCATACTTAAaCGTTTACAGCTGCAACCAAACTCAGCTTCTTTACATTCACGCTTAACGGAGC
TGAAATACTGTGGGCCATTGGGTCATCAAGGTTGTATCTACCAAATCGCATACTGCAAGAAAAATAACCGCATAATGTCTGCTGGCGCGGACGGGAAGCT
CGTACTTTGGGAATGTCGAATGCTCCAACCTGTCCGTATACCTGGGGTCAACACTCAAGGTGTGTTTACTCCCCTAAATGGATCGTATTGTGAAGGAAGT
CATGAGCTCCGGCCAGTTAACAATGTATCGAAGGTATTTCAACTTCCCACGCAAATGCCTGATGATTCACAGATAGGGGGAAGTCCAAGCGCCCAACCcA
AGCCTACAAGTATGTGCTGGAACGAAGACGGAAAGTCTATGACTGTTATCACAAGCACAAACTGTATTTGGGAgCTATGTATTGATAGTGGTGAGTGGAA
ACTTATGTTCGAAACTCGCAGCGGCTTCATGGCGGCATGCACTTGCCATCCAGCCAAGGAAGAAGTTGCGACCGTGTCATTTGATTTTTATATCGCTGTC
TGGGATTTACGGCGGCACTGTTGCAGTCGACGCGCGTTTATTGGAGGAGAAAGGTCGACTCAGCTTCCGAGTAGTGGGAAACCAGTTTGCATGGAGTTCC
ATCCGTTTGGAGATGAGATTGCTGTTGGTATGAGTAACGGAGAAATTGTCATCATTTCCTACAATGATCTGCGTATTCTCAAACGGAAATCAATCAAACC
TCATCTCTCAACTACCGTTGGGAACAATGAAGCGACTCAATCTGGGAGCGTTGTCGCAGCTACACAAGTCAAGTATGATCCCGACGGTAAGACGCTTGCT
GTCGGAGCAAAAGaTACGTTCATCTACATCTATGACGTTACTGCGGGTtATAAGaGGATTCAAGTGTGTGAAGGTCACTCAACACCTGTTTGCCACCTCA
CCTGGAGTGTGGATGGGGACGTACTACAGAGCAACGCGGTAGATGGAGAGGTCTTGTTTtGGAACCGATCCTCTGGAACGATCAAGCAGATTCCTGATGC
TTTTACTGTACGCGATACTAACTGGGCGAAATGGACGTGCGTTTtCGGATGGCCAACTCCTGGGATTTGGCCTCCAAACTCAACGAATCTCGCAGATATC
GCAGCAGTCGCAACATTGGGAGTCAAAGTGGCACCCCTACCAGTCTTGGGAGACAATTCCAGCGAATCTGTTGAAGATGAGACCGAAGACATCGTCGCAG
TTGCCAACAGGAATACACTACGGCTATTCtGTTGGCCGACTCCACGAGGCTCTCGGTGCAAGACGTACCACGCTCACTCTGCCCTCATCTCATCGGTGTG
CTTCTCATTCAATAACCGCTACATCATCACGACTGGGGGTGAAGACGGAACGCTCATGCAGTGGAGGTGCACGGTAACAGGTGATGATTCAAAGAGTCCA
CGGATAACTTTGCAAAAGCGAAAACACCAGTTCCGATTAAAGATATTAGAAGAGAACGGCGACACGAGCGGCGATGCGAAGGGTAGTCCGGTGCCACCTT
CAAACAATGGAAGACAAGGAAGTGGGCAACTGTCACCACGTCAAATGTCACGACAATACCGTGAAAGAAGTCCTGAATCCGAGGAGACACAATACGAGGA
TGGAAGTCCGTCACCTCGACCACCGtCTTCAcGCCcTAGGTCAGTGCAGCATGCGCAGTGCCGAGCCAAGCATGACTTCACGCCTGAGCACGATGACGAA
CTTCGTCTCACTGCCGgTGAGCTCATCCGGACCATCTCGAAaGAAAACGGTGAGTGGTGGCTAGGCGAGCGCTGTGATGGGACACGTGGCATCTTCCCTT
CCAGCTTTGTGGAAGAGGTAG