Description :
From Genome Similarity Track
Location :
Scaffold_46:181698- 191032
Transcript NameFunction/comments
Physo_136501hypothetical protein
Physo_157426OSJNBb0079B02.5
Physo_136503hypothetical protein
Physo_136504reverse transcriptase

Sequence
9334 bases(100 bases per row)
GAGATGATCAGGAGCTCGTGGAGAATGCGAACGCAGCTTGGCGACTCAGACTCGGACAACGGAACGCTTCTTTCAACCGATGGCACGGTACTATCAACTA
ATGCTGGTGGTATTGATTTCGACAGCTCGCGGCGACGAACGACTCAGCTCGAGAGTCTTCCGAGCTCAAATAGTTCGCGCACTCTGCAGAGCTCCCGTAG
TCTTGCGTTGGAGGAGAATCGACGGCGGACAACCCCGGTATTGGGCACGCACAACAACGACGAGACCAGTCTCATGAGCATGTTCACGTTTACACCTGAG
TGCCCCACAATGGTTCGGGAGCTGGCAGGCGCGTGCTTGCAGTACGACCCATCGCTACGCCCCAGCGCGTCCTACATCGCAGCCATGCTGCACATTTAGC
CAGGCCCAGATAGTATACATAACTCCAAAAAGTACAATACTTTAGTGATTGACGAAAGTGTACTCTGCGTAGTCGTCTTCATTCGTCTTCTCCCAATGCC
CGTTAGTCTCCAGTGCTCAGAATCCAAAAGTGAAGCATGGCGCGTGATACACGCAAGAGGAAGAAGTGTCAGGGTGATGAAGGCGTGCACTCGTGCGTTA
TGTGCCTCGAGCAGATGGAGGATGGCTTGGCTGCCTTGCAGTGCGGCCACATCTTCCACCACATTTGTTTAGAGCAGGCGCTTGCAAGCTCAAGGCGCAG
TTCGACTGTATTTGTCCCTCGGAGCTGCGGACTCGAGCCGTAGACAATCGCAGCATATCCAGCGCAGATTGGACAGTGCGAACGTGCAGTTGAAGAGATG
GCAGCGGATCGGTAGGATGTTTGACACCTGCGCCGGATGTCGAACACTAACATTTCGATGCGTGTTCGCGCCACGGCGGACCGAATGCTGAAGAAAGTGC
GCGGTGTTCGCGCTGCAGAGTGCGGATGGAGGACGTGGAGCGCGCCGCGCTCGAGTTCGCCTCTGCTGCCGGTCCTGCTCCCGGTGCTCCATGCTGTCAA
CGCCACCACCAGCCGAGGGCTGCGACCGCGCGGCGAACGGAGCCATCGCGACGCCGTTGACGGGATCTGTACGCCCTTTGAAGATCGACCGCGGGCCTGA
ACATGCTCTGTTCGACCAGACCTCGTTGCTCACGATGGCGGCGCACCCGCGTCGTGGTGCAGAGGGGGGGCTCAATACTTGGTCAGGCTTATAATCGGAA
TAAGTGTGATGGAATGCAAGGAGAGCCCGACTCCCAGGCAAGAAGGCTCAGCCCCATTTTGCTCTTCTGGCGAGACCCACAATTGAACGATGAGGGGTGT
CTATGTCGATTATGACCCGCTTCTAATCATAGGCTAATCACTCGACCGCCCGCAGTGACTGCAGTGCAGTCACGCAGGTGCTGATGGATCCCTCCAAGCG
GCCAAAGCGGCGAAATGCTCCCCCGCAGTCACATGTGTAGCGAACGCCATGCCCCGAGCAAGCCCGACTCCAGCTGACGCCCGTCACGCTGGACTGCAAG
CATCCGGAGCGCTACGTTATGGCGGCGCCACAGAGACGAGCCGGGAGTCGGTGCCGGCCGGTTCACTTGGGGTTTGTATGCGATCATGATTTCGACCAAT
CCGCGTGCCGTACCCATTCGAGCTTCCAAATCCCGCCGCATACAACCCCCAAGTGAACGGGGGCACCATCCGTTCCAATAGCGGAGCTCCTCCCGACCAC
CAGTGGATCTCGTGGTGACGCGGGTGCAGAGCAATCGGGGCGAATCCCGACGCCCGGGCTTTGCGCTATACAGAGGCGACTTGAATCGTTCTCCAAGTTC
CTCGACCGGACCCGCTCCATTGTTCAGATAACAAACGCCCGGGTGGTCGGTGGTCGGCTGGCTGGCGGAAACAGGTGCCACCTGCCTGCCATCCTGCTGT
GCCAAGTGGTCTGCCTGCCCCTGACGGACGCGATCGCCAGCTGCAGACACTTAGCAATATAAATACACCCCCTCACTCCACTCGCAGCCGAGTACAGTAC
AGACTGGTACTCCCCCCCCCTTGGTCCCTATCTCAGCCCCGTGGATGCTGCTCTTTGACCCTCCCAAGCCCTCCTCCTGCATGAAGAACTCGGACGACAC
CACTGACATGTGGCTCCAGCAAGTGGACGACGCCCGCGCGCAGGACGTGCCGCCCGCCGCGCTGCCGGCGCTGCAGCTCGCCGCCAGCAGACACCGGCTC
GCGGCCATCATGAACACGGACGATGCCACTGCCGCTGCCGCCGCCGCGGCGGTGCTCGTCGGCCGCGCCGCTGCCAGCAAGAGCTCGCTGGCCTTCATCC
TGGGGGGCAACGCGGACGAAGACCAGGCCCATTCGACTGGCCCAAGCTTCGGTACGTTGCGTTGCGTTGGCGGACCGTTGGATTTGCAGCGACCTCCGTG
GTTGGGCGCGGACTGATCGATCGCGTGCTTGGTCTTCCTACTGTACGTGCGTTTGCAGCTGATCTCACGGTTGGTTCAAGTGTGTCCGCGTCGGAGAACA
GGGCTGCCAACGTGCCGGCCCCTGCAGCCCCCAAGGCGGCAGTGAAAAAGTCGCGCATCTGCAAGTTTGAGAACTGCACGCGATACGTCGTGAACCGCGG
ACTTTGCATTGGCCACGGAGTAAGTGTTGGGGTGGGAAGTATGGTTGAAGAAGGTGGTGCGATGCTTTTGGATCTAACGGTTGAACTTGCCACGACCTGA
TAACAGGGCGGCAAGCGATGTGCAGTCCCGGGGTGCACGAGCAGTGCTAAAAATTTGGGCGTTTGCTGGAAGCACGGTAAGCATGACACGATTTGGAAAA
AAAGGTGGCTTCATGATTTGCTTAACAACAACGTTGCGTAACACGTGCAGGCGGCTCGACCAAGTGCACTGTTGCCGGTTGTGAGAATCGTGCCAAGTCG
CGCGGTGTTTGTTGGTCTCACGGCGGAGGTACGGCAACTTCAAACTCAATTGTTTTTTTCGTTTTTTTATTTAACAAGCATTGCCTCAACTTTTTTTTTC
CAGGCCGCAAATGCAGCGAAGAAAACTGCACCAAGACGGCGGTCTCCCACGGTCTCTGCTGGGCTCACGGAGGAGGTGAGCTGCATGAACTTTGTATATT
TTTAAACCTTACCTTGATATGCTGGGCTGCATGGGCACTCACTCGCTGGAGCTTCTTCTCCGCTGGACTTGTTTCTCTTTTGCCCTGCATTTATTTGTTG
CCCTTCGACTTGTTGTGCTACAGGCAAGCGGTGCGTTGTGGAAGGATGCCGTAAGCCAGCTTACGAGCGCAACGGCAACGTGTGCTCTCTGCATCAAGCC
ACCAACCCCGGTGCCTTGCAGAAGCCTGCCAAGCGATGATGGTAGTCCGCGCTCATTTTACGAGCGTGCGCATAGAGACCGATAGGAGACTTCCAGCAGC
AGCACGCCGTTGCGGGGACAAAGTCGAAGGAGTAGGGAGAGAGGCGCGTTGAATATTTATTGTCACGATAGTTTTGACGCACTTCGAGCTTGTAGAAAAA
GGCAATCCAAAATTTTTCTCGCAATGTGCTGCTTGTTGACGAGTTGAGTTGCGTGACCACCGAAAATAACTAAGCGAGCACTACAGATGCGACGCTCGCT
GCGAGCAGCGAAACGTAGTAACGTTGCTGAGTCGGCATCGTTGTAGGGGGGGGTCTCCCCGGGCCTTGCACACAAGCCACCTACGGTGAGGGGGGGGGGG
TAACGATACTAACCTAAAGTAGATAGTAGAAATAGATGAGAACTGGCTCAACGTCTCGAATACATGTACCTACTACTTCCTCCGGTTGGAAATGATCACC
GGAAGTCATTATGATAGGTCGGCAGTTTTTCTGGGACGGCCGAATCTTATACACGACAAAAACTAATTTATAAAGTGTAATTTGAGTTCAAAGAAGGACA
AAGGTATCTGAAGTACTTTTCATTTAAAGAACAGTGCAGTACCACGGTTTGAAGATTGGAGTAACGCAAGTGCGGCGTCATACAGCTCTCTACTGCACGA
TAGACTTACCGGTAGCTCATTCGCACGTCGGAGTTTGGCCTTCCCCAAGTGTGGTAGCTTGTAGAGATTGCCGCCAGCCTCCTCCAAGATTGCCCGCATG
TACGCCTGTAGCGTAAGAAAGATGTTGTCCACAGTGTCGGGTTTGAGCTCCCGAATGCGTCCTCAACCGACGCTATAAGCGCATCGATGCCCTTCCTTGG
TAGACGGTGTTGAATGCTCTGCATTGAAGCAAAAACTCCCAAGTCAAGGCAATTGAGCTCGGGTGAGTTGGCTGCTTGGCATAACAGCCTGATGTTCCAC
CCTCCTTCTGTGCCCGCTGCGACAACGTCCGGATCGGTTGGCGACACGTGCGGCTTCGCATTATCTTGTTGCATGAAGATGAACTGGCGACGGTCCTTCC
TTGGCCACTTCGACTTGATAGCTGGGAACACCTTGGTGATCAGATAGCCCTTGTAGACATTTCGATCGACGGTATCAAGATTGCGTGTGCAAATTTCCCC
CTTGGCTCTATTCTTGCTTTTACGCTGTGCCTTATACTTCTCCGTGAAAGACATGAGCCCCACCTTGCCATCCCATCTCTGCTTACGGTGTGGATCGTAC
CTACACAGAAATTTCATACACAGTGTCAAAGGTTATCCACAGTATAAAATTATAAAAATATAGAGACTTACCGAGGGCGTGCGAGTGCTGCCAGGAACAT
GGTCTTGGGTATGAAGCGCTTGCTCTTCCAGGCTCGTGGAGGCATCTAAGGTAGGAACGTCTGTTGCGGTCTGCGTAGAACCACTTCTCATCGACGTGAA
CCACGTTGTGCATCGACTCGAAGCGTAACGTCTTGTCGTCGATGAACGACATCGCATGTTCGACACGGTCCAGCTTGTTCTCGGGGGTCAGCGCCGGCTT
GATAAACGTCGTACGACGCCGTACCATGCCTTCCTTCACAGCTTGTCGTACTAGGTGCCGGGAGAGCCCTGAAGCAGCAGCAACGCGCCTCTCAACTGCC
CTATCCTCCACAGGAACACTCGCCAGCTTCGTCCGCACTTCATCTCGATTCTTACGCTTCCTGCCGCTGTTCTGCTTGATCCGGCTAGCCCACTCGCCAC
CAGGAACACCAGCCGCCACCGCAGCCGTGTAGCGCTTCCAAATAGCGCTCACGGTGGTCGGGCCACGCTTCACATGGGCCCCGACGCGGCCGAAGGCTCC
GCGGGGTAGAACTCCATTGTCACTTAGCTTGAGGAGCTCGTCGATGATGCCTCTGCGCTCCATGTCCACCAGGTTGGCCTTCGTCATGTTTTCGCGACTC
TAAACGAAGTACGGCAGTTGTGGCGGGTGCCCTCTTGATATCGGCTTGCTACTTGGAGCGGTAAAATGAAAATGACGTGGGCTACAGGGACCCGTTTGAG
ATGAAATCGGTGGCTATGGAAAGCAAAAAACAGACATTTTAACTAATAACTCCACCACTACGTGCTGTATAAAGCACGTAGTGGTGGAGTTATTAGCACG
TAGTGGTGGAGTTATTAGCACGTAGTGCTGTACACTATGTATAAAGCACGTAGTGCTGTATAAAGCACGTAGTGGTGGAGTTATTGGTTAAAATGTCTGT
TTCCGGTGATCATTTCCAACCAGAGGAAGTACTACCGAAGTTGATCACTTTTGATCCCGAATTCATTCACGTGGTCGGATGAGGCAACGGTGTAGGGTGA
TTCATGCTCTTTCATAAGACGATAATTGTCTTCAGAGTACTGCCGTACGAGTAGCGTCTTACGTTTTCCAATCAAGGCAGTTTGGCACTATCTTGATTTT
TGTATACAGCTGACTACATTGCTAATTGTCCACTGAAACGTAAGACAGTTTGTCGTACACGTATTTGTCTCGTACCATTGGCTGAAAGCCTATTCAGTTC
GTTCAGCACCCCGAAGAGCAGACCCCTCCCCATCCTCCACTCAGCCGTCCTTCCCATGCCTCCAGCCACGTCCGCAGAGCAGCCATCCCCCACAGGCATC
AGCACTAGCCAACCAACAGCGGCATGGATCCCTCATCTCGCGCCAGTGACGCTCTTAATGCCGAGAATGTACGCCGCGCGTGTACGACCTCGAGAACGCA
GCGTGTATACCGCAGCTATCGCCACGGGATAGCTGCGTGGATCCGCGAGTCTAAGGCCGATGCAGACCGGTATTTCGAGCCTGGTGGCGCAATTGACATC
TCCATGTGCACTCCCAAAGATTTCGAGGCGTTTTTGCTGAATGCCACTGAGAAGAAGCTGAAGGTGACCACACTCAGTGGTTATAGGAGCGCAGTCAAGG
ACATTTACCGACAGAAGAAGCTTCCTCTCCCTGCTGCGTACATGAACGATATGAAGACTTTTTTCGCTGGGCTCAAGCGCATCGAGGCGGAGCGCAACCA
AGGAAGTGCCGGCGAGGCAAAAATGGCGGGGAAAATGGCGCTACCGTACTCTGTGTACGAGCGAGTGTGTAAGCAGATGCTCATGCTAAATGACGGTGGG
TTTGCCCACCTATTTCTGACGGTGCAGTGGAATCTGATGTGCCGATCTCAGTCGGTCGAAACTATTCACACCGGGCACATGAGTAACGAAGACGACAGCA
TCGGCTTCGTCTTTCATAAGAGCAAGGCGAATCAAGATGGTAAAGGACCAAAAGACCCCCGACACGTCTACGCCAACCCATTTGCTCCATGGACATGTTG
CATCACCGCGCTAGGGGTCTATTGGGCGTGCTACACTCGCCAAGGCACCGGTCCGCTGTTCCCAGGCTCCCTGCAACGCAACCGGTTTCGCAAGGCATTT
GCCCGCGCCTTGGGAAATGCTGACGACGAAAAAAACTATGGAACTCATTCGGTGAGAAAGGGTGTAGCTACGTTCACGTGCAACGGGAGTACGGGAGGCC
CGTCCATCGTGAGCGTGTGTCTGCGCTGCGGGTAGTCTCTTGGAGGTGTCCAAGACCGCTACTTTCGATATGAAGCCGCTGGAGACCAATTTCTGGGCCG
TGTTGGGGTAGGTTTGCCACTGAACAGCGCCGGTTTTGCTATACTACCGCCCCACTTCAAAGATAATACCGACCCAGTCGTGCGTGAAGGTGTGAAGAGT
ATGTTTCCAGCGCTGGCTTCTGACTCTAGCCTGTTATTAGTCCTCAAGCTCTGCTTAGCGTCGCTGGTGTTTCGCAGCGATTTTCTACTGTCCCAACTCC
CCGGTACATCGATTTTCCGATCCAAAGATTTAAGGGAGCAGCTCCGATCGCGGCTTGTACAAGTAGATTCTCCGTGGATGACTGCTACCGGTATCCCACC
TCAGGTGGTCATGTTTGGGCTACAAGAAGAGATTCGGGTTACAGTGTGCGCTCTACCAGAATCTATGGCTGCTAGATTTGCTCAATTACTGGAAGAGAAC
GGGATCTGTGGCGGGGGTGTTACTCAGCAGCAGCTCGAAGCAACATTGCGCCGCGTAATGGGGGAGAATAATCAGACGCAACAGCAAAATGCTGCAAGTC
GACCCGGTGGCGATGCACCACGCACCACTGTTTACTTCTGGCCAAGCGATGGTAAATTGCACACTCTCCCAGAATCGTTTGAGTTTCCTAGCACTGATGT
GCTACATGCGTGGCATTTATGGTAGTTTGGGAACGAAGATGCCGGGCAGCCTCCGTTCGAGTCAGTGAGCACGCGTGATCTGTCAACGAGGAAGAAGCGC
CAAACGTATTCCGAGTGGCGTGTGATGATGCAGCACATCTCAACGGCAATCAAACGCGCAACAGGCACGCCGCCTCCTTCCTCCATGACAGAGCAGCAAG
CTGCCATGCTCTGCATCGCTGGTGTCAACAGTCTGCAGCTCAAGACTAGCCGTCATACCCGCCGACCAACCCAACTGAAAGTCACGACTATGCTGCGTCT
AGTTAGAGAGGCTGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGACTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCT
CAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGCCGCGC
CCCAGGAACCAGGGGAACACCGGGCACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACTCTAAGTCTCCATGAGGGGCGTGCGGGTGGCGCACGCCATGG
GGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTG
AGAATCTTGATCGACTCTGGGGCGTCCACGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCAACAAGTACGCCGATGCGCTACGAGGCAGCAAAG
GCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCAC
GGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGTGGCAAGGCC
ATCAGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGATGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAG
CAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGAGCCGGACGAGGCCTGAGAGTGGAGGTGCCGGACAGCGCCTACCAGGT
GGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGTCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGC
GAGGTCACTCAGACCATAACTGATGAGGAAGGCACTGCAGGCGCTTCCGGTGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGG
GAGTCGCTAGAAGCGCTCCTGGTGTGGGTAACCAAGTTCTACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAA
GGACCAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAG
CCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCG
CGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGA