Description :
From Genome Similarity Track
Location :
scaffold_22:181696- 184067
Sequence
2371 bases(100 bases per row)
catgcaggacgggcttaacaagctgatgctttgccctgagggcgtgcaacaccttgtagcacaaggccccgaggcaatcggtgcgcgtctaaaggcgttt
tcaaatatcGAAAACGCGctactagagcacctgcagcagaagatgcctGCAACGTTTGCGTCAAGACGCCACCGTcacccgacctaagccgctcatggtg
agtgttaaggtctttgagggggaagatagagagaatctcctactccgggtgagagaggtAGAGATggtcatcgcatccgccatgctccaaaccgagcaac
agcgcgtagcgctagccatctccaagctcggtagtcgagcgcgagaatgggcactgacgtgcggcacttcggtcgaagctgcagttccctcctgggcgga
gctaaaattgcagccttcccgagtgttctcgccgcctaatgaggcgtatcgcgtgcgatggcgtttccttgccgcccgacagagtaacaaggaattgttg
gactttgtccaagagttgcgaactctcattgccgggacggcagcagatcccctcccggaggcggccacagtgaccgtctttatggaaacctccgcactgg
catggccagaatggaagtcttccgtgtggaTCCGTCCTCGTCTAAAGATGCGGTGAAtgcggcattgaatgccaaattcaaattcATGTTGGCACGACAT
AGTTGGAacgcacactccaacagctcgtcgagcgggcctatgcccatggatctcatctATGCTGgagacgagggagcagagctccgagctgccgggcagc
cgggcagcatacacacatttgacggtgttttgtccgtggagacacccgtcacctgcggaacggttgccccctgcgcaaggcgcgtcaaggttcNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN