Description :
From Genome Similarity Track
Location :
Scaffold_74:181625- 183705
Transcript NameFunction/comments
g4538.t1hypothetical protein

Sequence
2080 bases(100 bases per row)
TACCTCCACGAGCCGGCCATCCTGTTCAACCTTAAGCACCGCTTCTTGCGTCAAATCCCCTATACATACACGGGCGCCATTTGCATTGCAGTCAACCCGG
TACGTCAGAACATCCTATTTTGTTCCCTTTTCAATGCGGAATATCCGGATATTATCTAACGCGAATATGTCGCTATTTCAGTACTCGTGGCTCGATATCT
ACACCAAGGAGCTGCAAGAGCAGTACCTGGAGCGCGACCGCAGCGAGTTGCCGCCCCACGTGTACGCGACCAGTGCCGGGGCCTTCCAGCACATGCGCGT
GTTCGGAGAGGACCAAAGTATCCTGGTCAGTGGCGAGTCCGGCGCCGGTAAGACGGAGACGACCAAGATTTTAATGTCTCACTTGGCATCGGCCGGCAGC
CACTCAACATCTGACGCCCAGGCCAAGGAGGCCAGCATCATCGAGCGGGTGCTGGACGCCAACCCGCTGATGGAGTCGTTCGGTAACGCGAAAACGTCGC
GCAACGACAATTCCAGTCGCTTCGGTAAATTCTCCGAGTTGCAGTTCGACGCTTTGGGTGATTTGATTGGCGCCCGCTCGCGCACGTACTTGCTGGAGAA
GTCGCGCGTGTCACTGCAAGGTCTGGGCGAGCGCAATTACCATATTTTCTACCAGCTGCTGGCGGCCCCCGAGCACGTGACGACGGAGGTGAAGGTCACG
GGCATGGAGGCCAAAAACTTCCCGTTCATCAAGCCGCACGACGAGGACCTCGCCAATGGAACTGACGTCAGCGCGGGATTGAAGGACGCCGAGAGATTCC
AGCAGACGGTGTCGTGTCTGGACACGATGAGTGTGTCCAAGGAGGACCAGATGAGCATCTTCAAGATTGTGGCGGCCATTCTGCACCTGTCCCGCATCCA
GTTCGAGCCCACCCCTGGTAACGATGACGCGTCGCAGCTGACGAGCACCCCCGAGAACCAGCACGCAAGCGAACTCGTGTCGCAGCTCCTTGAGTTTGAT
GACAACCAGCTGCACACGGCGCTTTGCACGCGCGAGATGACGGCGGTCATGGAGACGTACGAGGTGCCTCTGAACGTCTCGCAGGCCGAAGGTGCGCGAA
CTGCTTTGGGCGTGGCCCTGTACTCGCACATGTTCTCGTGGCTGATCCACCGAGTCAACATGTCGACGAGCGCGTCACACGCGGATGTGGCTCACAAGAT
TTGCATCCTGGATATTTTTGGCTTTGAAATCTTCGAGAAGAACTCGTTCGAGCAGCTGTGCATCAACTACGCCAACGAGAAGCTGCAGCAGAAGTTTACG
CAGGACGTCTTCAAGTCCATCCAGCAGGAGTATGAGGACGAGGGCATTCCCTGGACGCGCATCGAGTTCGCGGATAATGTGAACGTGCTGTCGCTGCTTG
AAGGGCGCTTTGGTGTGTTGTCGCTGCTGAATGAGGAGTGCATGCGCCCCAAGGGTAGCGATGCCGCCTTCGCCAACAAGCTGAAGGCTCATTACAGCGA
CAACGACCGCTTCGAGTGCCCGCGCTTTGCCCGCGATGCATTCGTTATTAAGCACTACGCCGGACCTGTGCAGTACGATACGAATGGCTTCCTGATCAAG
AACACGGATGCGCTTCAGAACGACCTGATCTTGCTGATCAAGAAGTCGAAGGCGCCGTTCCTAAAGAAGCTGTTCCCGGACGAGCACGTTGGTGATGCGA
TGACGGGTATCCCCGGTACGAGTGCAGCTTCTGCATCTAATGCTTCACGTGGGCGGCCCGCCCTTAAGCGCAAGAACTCTATTGTTGCCGACACGGTGGG
CACGCAGTTCAAGAGCCAGCTGAACGGTCTCATGGAGGATATCCGTCGCACGAACGTGCACTACATTCGTTGCATCAAGCCTAACGGCAAGAAGAGCCCA
CTGATCTTCAACAAACTGCGCGTGACGGAGCAGCTGCAATGCGCTGGCGTGGTGGAGGCTGTGCGCATCAGTCGCATGGCGTACCCCAACCGTGTACTGC
AGACGATGTTCCTGGAGCGTTTCCGTGGCGTGGCGTCGACTACGACTGTGGACGGCAATCCGTCCGCCCTTGCTGTGCTT