Description :
From Genome Similarity Track
Location :
Scaffold_74:181619- 183599
Transcript NameFunction/comments
g4538.t1hypothetical protein

Sequence
1980 bases(100 bases per row)
CTGAACTACCTCCACGAGCCGGCCATCCTGTTCAACCTTAAGCACCGCTTCTTGCGTCAAATCCCCTATACATACACGGGCGCCATTTGCATTGCAGTCA
ACCCGGTACGTCAGAACATCCTATTTTGTTCCCTTTTCAATGCGGAATATCCGGATATTATCTAACGCGAATATGTCGCTATTTCAGTACTCGTGGCTCG
ATATCTACACCAAGGAGCTGCAAGAGCAGTACCTGGAGCGCGACCGCAGCGAGTTGCCGCCCCACGTGTACGCGACCAGTGCCGGGGCCTTCCAGCACAT
GCGCGTGTTCGGAGAGGACCAAAGTATCCTGGTCAGTGGCGAGTCCGGCGCCGGTAAGACGGAGACGACCAAGATTTTAATGTCTCACTTGGCATCGGCC
GGCAGCCACTCAACATCTGACGCCCAGGCCAAGGAGGCCAGCATCATCGAGCGGGTGCTGGACGCCAACCCGCTGATGGAGTCGTTCGGTAACGCGAAAA
CGTCGCGCAACGACAATTCCAGTCGCTTCGGTAAATTCTCCGAGTTGCAGTTCGACGCTTTGGGTGATTTGATTGGCGCCCGCTCGCGCACGTACTTGCT
GGAGAAGTCGCGCGTGTCACTGCAAGGTCTGGGCGAGCGCAATTACCATATTTTCTACCAGCTGCTGGCGGCCCCCGAGCACGTGACGACGGAGGTGAAG
GTCACGGGCATGGAGGCCAAAAACTTCCCGTTCATCAAGCCGCACGACGAGGACCTCGCCAATGGAACTGACGTCAGCGCGGGATTGAAGGACGCCGAGA
GATTCCAGCAGACGGTGTCGTGTCTGGACACGATGAGTGTGTCCAAGGAGGACCAGATGAGCATCTTCAAGATTGTGGCGGCCATTCTGCACCTGTCCCG
CATCCAGTTCGAGCCCACCCCTGGTAACGATGACGCGTCGCAGCTGACGAGCACCCCCGAGAACCAGCACGCAAGCGAACTCGTGTCGCAGCTCCTTGAG
TTTGATGACAACCAGCTGCACACGGCGCTTTGCACGCGCGAGATGACGGCGGTCATGGAGACGTACGAGGTGCCTCTGAACGTCTCGCAGGCCGAAGGTG
CGCGAACTGCTTTGGGCGTGGCCCTGTACTCGCACATGTTCTCGTGGCTGATCCACCGAGTCAACATGTCGACGAGCGCGTCACACGCGGATGTGGCTCA
CAAGATTTGCATCCTGGATATTTTTGGCTTTGAAATCTTCGAGAAGAACTCGTTCGAGCAGCTGTGCATCAACTACGCCAACGAGAAGCTGCAGCAGAAG
TTTACGCAGGACGTCTTCAAGTCCATCCAGCAGGAGTATGAGGACGAGGGCATTCCCTGGACGCGCATCGAGTTCGCGGATAATGTGAACGTGCTGTCGC
TGCTTGAAGGGCGCTTTGGTGTGTTGTCGCTGCTGAATGAGGAGTGCATGCGCCCCAAGGGTAGCGATGCCGCCTTCGCCAACAAGCTGAAGGCTCATTA
CAGCGACAACGACCGCTTCGAGTGCCCGCGCTTTGCCCGCGATGCATTCGTTATTAAGCACTACGCCGGACCTGTGCAGTACGATACGAATGGCTTCCTG
ATCAAGAACACGGATGCGCTTCAGAACGACCTGATCTTGCTGATCAAGAAGTCGAAGGCGCCGTTCCTAAAGAAGCTGTTCCCGGACGAGCACGTTGGTG
ATGCGATGACGGGTATCCCCGGTACGAGTGCAGCTTCTGCATCTAATGCTTCACGTGGGCGGCCCGCCCTTAAGCGCAAGAACTCTATTGTTGCCGACAC
GGTGGGCACGCAGTTCAAGAGCCAGCTGAACGGTCTCATGGAGGATATCCGTCGCACGAACGTGCACTACATTCGTTGCATCAAGCCTAACGGCAAGAAG
AGCCCACTGATCTTCAACAAACTGCGCGTGACGGAGCAGCTGCAATGCGCTGGCGTGGTGGAGGCTGTGCGCATCAGTCG