Description :
From Genome Similarity Track
Location :
Scaffold_1630:1816- 4153
Sequence
2337 bases(100 bases per row)
CGGAGTTGGGTATGAAGGCGGATCCACCAAGGGGCCAGTTGGTTCCGCCGGGAGCTCCCCTTCCCCGAGGGATTCGATCGCGGTAGTCGCCTCATACGCC
AGATCCTGCCATTCGCTATAGCGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCATCCTTCGTCAACCATCGCCCAATCTCCTCATAAT
GGTCCAGTAATAGTCTCTTGTCGGTAACATTCGTGACCTGGAGGTATTGTGACCGACCTGGTCCTTGGATTACTGTAGGCATTCACTTCGCACCCCGAGT
GACCCACAGTTTCTCATATTCCACCCATTTCAACCGATCTGACAGTCCCAGGTTTATCCTGGCTCAATCCAGGTCATCTTATCCGCCCTTATGGTCATCA
TATTCGCCCGTACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCCGGGAAACACAGTGTCCCATCCGCCAGATCTAACCTTACTCCGGCTGGT
ACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCAGTATACCAAACAACCAGCCAGCGTGATCTTGATCC
GCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGT
ATCTAGTATAGACGCCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCATTTTCCTGGG
GCATGATACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCACTCTCTTCAGACCCACGGGATCCAGTGACCTGACAGACCTTAGGTG
GATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACAATCGACTATGCTGTCGTTTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGA
AGAGACCTCGAATATGGCAAATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGG
GTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTA
GTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCAGGATCAAACCTTTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTG
CCGACGTCATGAATCTCGCCACAACTGCGACACACGTAGAAGCAATGATCTCCGGGATGACCCTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGC
ATCCAGATTCGGTGTGCTTTTGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAAATCTCGGGATCTGTACATCCCACGGTCCCCGGG
TACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCTTTCGATCGTTGGACGCAGTGAGACAGACTTGACGGTAATCTTCAGGGTCGGAGTCCGAA
CCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGG
ATCCGACCGCCGCCTTCTTCTGGCGTTGTTTCGCACGATCCACAGCCCGCAGCACTTCTTCGAGTTCATCTGCGTCTGGAAGGCGTAACAGGGTAAGCCT
GTCGGCCAGATCCGCATCTCCCAACGTCTCAATAAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGA
CCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGT
ACTCGGTCTGGAAATTGCGCAGCTGATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTTCTGGCTGGGCCGCTAGCAGATCCGCA
AAGGTCAAACGCTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCGCGCTCGGTCCTCATCTTGATCCATGC
CCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGTACGATCCTCCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGA
AGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCA