Description :
From Genome Similarity Track
Location :
Scaffold_38:18154- 19778
Sequence
1624 bases(100 bases per row)
ACTCGAGGGTCGAACTTGTCGGCTGCTGACGGCTCTTGGGGTTGCGTGCCCACTACGCGACGCTGCGCCACAGAGGACGTGGCATTAGCTGTCTGTTTCT
GGCGGAGCTGCTGCTGTTGTGTCAATTCGCGCTGGCTAGGACCACTGCCAGTGGACTGCAAATGCTTGAGGGCTTCCGCGCGCGCTTTTTGGGCCGTCAG
CTCCTTCGCGAGCCGCTCGGCAGATTTGGGCGGCATCCTACCTCGTCGACAGGCGTTCAAGCTGTCGGAATGGCCTATTGTTGTGTCAATAGCTATTCTA
TGACATTCGGGGATAAGAGCATGTTTCAAGCTGAAGTTGCCCTACAAGTGTGTTCCGTGGTGACTAGTTTGGCGTGGTATTTGCTGATGATGCAGCCTAT
CGGTTAATTGTTCTCGAGTACGAGCTTAGCAGTCACTTCGGCGGACTCCGTGCAGACACGGGCAGAACGATCTGCGAAATGGCAACGTGCCGCTGGTCAA
CGGGGCCTTGACCTGCAATCCATCGGATACTCTCATACCTTCGGGCTGCACTTCACTGTCAATGTCTGAAAATAAGCTGCCAGCCTGAAAATACCCATTG
TCGTGGCTCTCGCTGGTCGGAGTTATTTCGAGGTTGCTTGATGTAGTGAGCGTGAAACCTCACGATCGCATCGCTACTCATGCACAGTGTTGACCACTGC
TTCTCATTCTCCATCGGGAGCTCCAGACTGCAGATTGTGTTGCCGGCTAAGCGCAACCAAGCACTCGCTTTATTCGACGAGAAAGGGCACAACTCCAGCA
GTTGCTTTCAACTGACACGATGCTCAGAAGGTGAGCTTGGCCAACTGGGAGCTCAAATCACCCGCGTTAGACTCATATTTTGTTACGTGCAGCAGACCAG
AGCACAGCTCTCAGGATGAATCATGTCCTGATCAAGTTACCAACCAGAGTCAGGAGATTCGGCCGACATCGTTGCCAGCGCCGCTTTCTGGCGCCGAGGT
ATGTGAATTGGGTGTAGGGGGGCCAGCTGGCCGATTTGACTCAATCGATGATGGTGTTTCAGGCAACTCAGGCACTGCTGAAAGCAAAAATTCGTGAAAT
TCAATCGAGCCCCGTGTTGACACCGAAGCAAAAAGCCGAGTCGGTACAAAATCTCATGATGAAGGATTGGAATGATGCGAAATCCAAAGCGGGCGCTTGC
AAAGCCGAATGCGACACCGAGGCAGAGCGCACACAAACATCTTACCACGTACGAAGACGTGTGCGTTGGTCGTGCAAGAACCTTGCCAGTCTAACATTGG
CGTATTACAGGACGAAGCTAAAACGGTGCTGGGGTGCAGCCACTACCAGTACGTGCTTGCCTTATGAATACCCAAAGACGGCTTTACTTATCGTTGTTTA
TCCTGTAGGCGGAAGTGCAAACTACTCAGTAAATGCTGCGGGAAGTGGTATTCATGTCGCTTTTGCCACGGTGAGTCTTATTTTACGGGATATTAATCTC
TTCATATGCGCAACCAACGCTGACCATTGTGCTCGCCTTTTTTGCAGATGACAACGAGGATCATGCATTTGACCGCTATGCCACCGAGTCAGTGTCGTGC
ATGAAATGCGACACAGCTCAGGTA