Description :
From Genome Similarity Track
Location :
Scaffold_85:181508- 185153
Sequence
3645 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAGCCTACCTTAAATTGTTTTTTTGGTCACCTCGCTCCCTTTAAGTAAAAAGGGACCTGTGAGCTGCCGTTCACTG
AGAGTTTGTAAACTCTCAAAAGCCAACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTTACCTTTGATAGCACTCGCAATCAATCCACGCCAAAGCTGG
TAGACTACCTGAACCTCTCTAAGATTTGTTGCCTTGGATATGAACAACATTATCAATCCGAACGGCTCACAGTTCGAGTTGGTTCAGAAGATGGCAGGTA
TCTTCGAGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGCGCAGCTCGAGCGCGTCAATGCGTTTGACGCTTACGAGCAGGGGCTCATCGC
GCATGTGCGGGAGAACCTGCAGGCTCCGGCGGTGGAAGCGAATCCACCTCACCCGAAGCCAATACGGCTGAAGTTTAAGCCGTATGAAGGGAAGGAAGGT
GAGAGCCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTTATCTCGACCGAGCAACTTCGGGGTTGCTTTTGCACTCACCAATCTT
AGCGGCTGTGCTAAGAGTTGGAGGTACACACAAAAGGCAACATCTACTGAATGGTTGACATTCTGTGGCTCACCGGTGACAGCACCTTCGAGGCCGCGGT
CCTGCCGACAAACGTCGAGAATGCCAAGGCTCGGGCTTCGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAACGTCTTATGGCCATTTCGATGCTGAAATAGACGCGTTGATCATCAATCCAC
CCATAGCATTTGATGCCCTTCGACGTGCGTTTTTGACTTGGGGTGATGGATATCGTTTGCAAGTCTCTGGGAGAATAACTTCGACAGTCATTTCTCAGCA
GGAAAATTGTGATCTTCTTAGTTCTTAGACCCTTGATGCTTGGCCGTGGTTTTGACTAAGAAGCGTACAGCCATCGCCAGGTGCGTACGCCGGCCTCGGC
GTGGCCTGGGAGTTCCTTGTTGACTCCCGATCGAACGAGCCCCAACAGACCAGTTCCCATTGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTT
CGGCTGCGGGAAGATGGACCACTTCAAGTGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCTTTCGCCAAGCCCGTCCTAAAGAGTCGCTGGTAGAAG
CCAGGATCTCGGGGACAGGGGAGCGCCGGAAACCAGTAGTGGCGGGGCGCCCTACTGGGGAAGAGCTAAGTCTTCTTGATGGGTGCGCGGGTGGCGCGTA
CCACGGGTACTTAGCCCCTGAGAGTATTCGCACCCTCGAATCGGTGAAGAGCAGCGGCGGGTTGCTCGTAATACACGGATGTGTACGGGGATACGATCAT
CCCTTTAGAATCTTGATCGATTCTGGGGCATCGAAGAATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTGTCCGATGTTTTGAGAGAAA
GCAAGGGCAACGGGACAGTATCAGAGTGACTGGCTGACGAGAAGGTCGTCACTGTCCCCAACGTCCAAAGTGGATCTGGCCGTCAAGCTTGAAGACTTTG
ACAGCCTCGAAGAGCTCACTGTTCTCGACATAAATCCATATGATATGATCCTGGGCATGCTCTGGCTGAGAAGCACGAGCCCTGGATCGGCTGGCGAGGC
AAGGCAATCGGTGCCAGTCGCCCTGCGCAGCCCGACAGAGCATTGGTGAGGCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTACCCGG
GGACCAAAGCGTCCGGCAGACGCTTGGGAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCAGCGCCCAGAGGAGGCGCTGGCCAAGT
GAGTAACTTAGGTCCACAAGCGGGTAACTTAATTCCGCAGACAGCTGCAGCTGTCACGAGCTTTGACGATAGCGTGTTCCGGGGTGGGTAACAGAGTTCC
ACACACGGTCGCCCGGACCTTAGCTGAAGAGGAAGACGTCGAATAGGCTTCCTGTGTGGGTAACATAGTGCCACATGCGGTCGCCCAGACCTTAACTGAA
GAGAAAGGTGTTGAGCACGCTTCCTGTGTGGGTACCACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTA
GCAAAACTCCACGGTCGCCGTCGACGACGACGTCGCTTCAAGCGACTCGGAGTCCAGTGCCTGAACTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCGC
ATCTTCGATGGCGAGACCGGCTTACTCGTCAAGGCATCTGGTGTCCACTTGGAGCCGTTGCCAGAGGTTGTAGAGATACTGAACCTCGAGGAAATGACGG
TCGAGTCTTTCCTGGCCAACCTCAAGGCTGGGAAAGGTTGCCGAAATGGTGCTCCTGAGACCTGAGACCACTCGGCAGGAGCTGAACTCTTCCTCTGTTT
GGACGAGAGCGTCCTGGAAGACCTGAACAAGCAGCATCAGACGCGCTTGGAATTCTGAGATCCTTAAGAATCCCCAAGGATCCGGTGTATCCTTTGGTGA
CGAGAGTATGCGGACGTGGTGAACAAACACCCACGAGACCCAAAATCAACCAGATCGAGGCGTACGGCATTAGATTGATCTCGTGCCAGGCACAAAGTAT
TGTGTCACGAGGTAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGATAGCGAAGGCATGCATGGTGCGGGAGTCGAAGT
CCCCGCACTCGACGCCAGCTTTCTGCGTTCGGAACCCGAACGGAAAGTGCCGTCTAGTTCATGCTTATAACAAACTGAACAGCGCGATGGTGCCGGCCCA
AACACCAATCCCACGAAAGGACGTGCTGTTAGACAACATGGCAGGAAGTGTACAGTAAAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCTTGATG
CGCGAGAGCGACATCCCACTCACCGCGGTGGGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGT
TCAATCGCCTGGTGACGCAATTGTTCATGCCACTGCGCGCCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCAGTGCCGAGGGACGCAAGAC
GGCCATGGAGGTGCATCTGGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAGCAGGCTCTACGTCAACATCGACAAATGCGTCTTCGCGTCATCAG
AGATTAAGGTTCTTGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAGGGCCATAGCAGCATGGCCAACGCCCCGATTCCAGAA
GGATCTTCGAAAAAGGTTGGGCTTGGTCAACTACCTTCCCAAGTACAAAGCAGGGTATGCGGGCTTGACTAAGCCCTTGTCGGGCCTCCTTCAGAAGGAC
GTCGACTGGCACTGGGAGCAAGAGCATTGAAATGATTTAAACGAC