Description :
From Genome Similarity Track
Location :
Scaffold_80:18150- 21063
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-snap-gene-0.23Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.12Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family

Sequence
2913 bases(100 bases per row)
ATTACAAACAGCAGCTCAAAAATGCCAGAGCTTGAAAAGCTGCCTGATACTGACTGTACTCCCAGTCAACGAAGATCTGCAGGACAAGATGGACGAGAAG
GGCAAGAGCCTGCAGACGCAGCTGCAGTTCATGGAGCGCAACGGCCGCGCGCTCGAGGAGCTCATCGCCAAGATGCTGCGCGTGCGTGAGGAGCAGGAGA
GCTTCTTCGCGGGCTTCGCGCGCTCCATGCAGGACATCGGCGCGCAGGAGGGCTGCAAGGAGATCGCGCAGTGCCTCGTGAGCCTGGGTGAGAGCGGCCA
CAAGCTCACGGTCGAGACTCACGACGTGATGCTGCAGCGCCCTGAGGCCGAGATGCTGCTCACGCTCACGCAAATCCAGGACTGGGGCGTCGTGCCCATG
AAGGTGCGCTGTTTGCTTGCAAGGGTTGATGAATGTGTGGCATAATGGGATACATGGCTAACTCTAGTTCTTAATGCGACTCTGTAGAGACTGCTGGAAG
ACCGAGAGAAGGCGCTCAAGATCGAGAGTAAACTGCAAAAAGAGTACGATGAGAAGGTGCGAGTGTGCCTGTGTTGCTTGTTCTGTAGTTGTCTGTGTGA
TACGAGTTCTCGATCTCACCGGGCTTAGTCATGTTTGTTTGCAGCGTGGAGGTTCTGGGAAGGAGAAAGAGAAGAAGCTGCGCATGCTCACGGACCAGAA
GCGCCGCGTGGAGAACGTGAACGTGCTCATTGAGTACCACATGCGCAAATTTGACGAGTTCCGCCTCCTGAAGATGAAGGTGCGAAATGATTCTTTGCAG
TCCGAATGCTCAGTACTGCGGTTGTTGTTGTTCTCACTGGCGACTGAACTATTCGCTGTGTGTCTCCGTTCTTTTTATCCCCACCTCAATAGAAAATCAT
GAGCGAAATGGTGCGCTCCAATATGTTTTACCACGCGAAGGGACTTGAACTCTTTTCCGTCCCCTGCGCGCAGATCTTCAAGCTGCAGGTTCGTGTCCAG
GGAGAGGTGTGTGTGTGAGAGAGAGCATGAACAGATATTACGAAGCAACTTTCATGACAGCTCGCAATGGGCAAAGTATCTGATTTGCATTCTTTCCGTT
CACATTGTGATTTGTTGCAGGAGTAAAACGAGCTTGAGCATCAAGAACACCAGCAGATCTCGCATGTTCGGTCGATTCGCCACTGTGCAGTTCGTGTGTG
ATCAGTCATGTAAATGCGTATTTCTCTGTCAGTCGAGTTATTTCGTTGCTGAATGCGACCAAAGTTCCAACTCATATCTCCATATATTTATTACAAGCAA
GCAGCAAAAGCGACCAAGCTACCGTACCAGCCAGACGGCTCTGGGTCTAAAGCGGACCAAAGCAACCAAACTACCAACGAAAGACCTACGCCCAGATGGA
GAGTACACCCATGATGCCGAATCCTGCGAGCAATGCACTGCACTTTGGGATCAGGTCCTCCTGGTTCTTGAGCTCCTGCGGGATCACTTCCATCACGGCG
ACAAACAAAAACGTGCCGCCCGCGAGCGCCGAGCAAATGCCGCTCCCCATGCTCTCAGTGGTCGTGTCGACGAGCAACCAGCCGAACAGGATGCCCGCGG
GCGTCATGATAGAGAACACACCGACCGACGAGAGCACGCGGCGTCGAGGAACCTTGTGGTGCAGCAGCTCCTGCATGAGCGCGAACGCCGCGAGCGACTT
GTGCGCAAGCACCGCGATCAAAATATCCCAGGCGGCGTGGTCCGACGCGCCGATGCCCATACCTTCCATGACCGAGTGGAACGACAGCGCGAGGAACACG
ACAAACGCGAGGATCGGCTTGGCGTCCATTATGCCGTGCACATGCGTGTGCGTGACCTCCAGGTCGACGAATTGCTTGTCAATATTTGGAGTGCTGACGA
TGGACTGGTCATGCTTATCATCATGAACATTGGTAGTGCTGATGCTCGTGCTTCCGTATAGCGTCTTTGGCGTTGGCTCTTCGTGCCGTCGATCACTGTT
GCCGGTCTCGAGATCGTGGTCGTGGTGGGTGTGACCAAGGTCTCTGTCGTCACCTTGGAGGTCGTCATCCTTATTGGAGTACAATCTGAGTGCTTGAGGA
GAGTTGGCGATGGAGGCGTCGGTCTCCTCAGAGGAGCACGACTCGTGACGATGGTGGTGCTGGCTGATACTCAATTGGTGCTGCAGATCGTTGTCTCTCA
TCGTAACGGAGCTGGATGCCATCAATGGCGTGCGCTCTTGGACCTCGCTCTCTTTGTGGTGGTGGTGTGCACTGTCCAATTTGTGCTGCAGTGCGTGCGC
AAACACCTCCATGAGCAGCACGAGCAGAAAGCCGCAGCCGAAGAAGAAGTTGGCCCACTTGAAGCAGCCTTCCTCAGACGAGCAGAGCCACTTCGCAAGC
GCCTCGTTCTCCTGTGCGTCGGGGAGCAGGTGCAGGCACGCGCCCGAGAGGAAGATACCGCCCGCAAACATGTTGAGCACGCTCGTGATCAGCGCCTGGT
ACTTCTTGTCGTTGCTGCTCTGGTGGTGGCGCTGACGCTGGAGAAGCAGCGGCCCAAAGCCACCGACGAGTGCGAGCACCCAGATGAGCCCCGCCGAGAA
GAGCTTGAACTCGGTCACGTATCCGAGCATTCTTTGGTGGCTGTGGTACGTTGAACAAATTGTGGATCCTTGGTGGCGAATTGTAAAATGGGGGGCGGGC
AATGAGATCTCATTGCGATGGCTTTTCTCGTAAAGACATTTGTCCGACGGCGGATCGCCGGTGGCGGCAGCGACAATGGTTGTTTTTGGTATTGGGCGAC
GGAGGGACTTGTGCCCGTTATAAAGTTTGACCAGTTACAGCTTGGCAAGTGCTTGAGTGGCTTCACTGAGAGCGCAAGCAATTTTTTGGTTCGCATTTCG
ATGGGCGGAAAAG