Description :
From Genome Similarity Track
Location :
Scaffold_787:1815- 2855
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_787-snap-gene-0.5Glucan 1,3-beta-glucosidase

Sequence
1040 bases(100 bases per row)
TCCAAGACGAGCGTGCTGCTCGCGGTCACGACTGCGTGTCTGGTGGCGTCGCTGTGGACGCCGACCACGCACGCACTCAACCTCAAGCTCTCCGGCATCA
ACTATGACTTTCGCCGCGGGACCGACTGGGATGTCGAGCGCTGCAAGACCAGCGCCGCCATCACGAGGGAAATCAAGCTCCTGCAGACCATCACCAACCG
CGTGCGCGTCTACAGTCTGACTGACTGCAACGTGCGCGACGTGCTGCGCTCCGCGACGACGCTCAATATGACTGTGTGGCTTGGTGTCTGGGTCAGCAAC
CGCACGTCCGTGTTCACCAGGGAACTGGCCACGCTCAAATCGCTCATCTCGGAGAAGCTCGTCACGAACGAACTCGTTGACGGCATCAACGTCGGTAGTG
AAGTGCTGTACCGGAACGACACGACGCCGCAAGTGCTGCTCGAGAATTTCAAGGCCGTCAAGAATGTGCTCACGACCAGCGGCCTCACGATCCCGCTCTC
GATCACCGACACGCTCGGCGAGCTGTACAAGCACCCCGAGGTCGTCGCTGTCCAAGACGTCGTGACGTTCAACGTGTTTCCCTNNNNNNNNNNCTGGAAC
AAGGTCGCGATCGACAGTGCCGTCGTGGATCTCGAGGCGTCGATCGACGCCGTGGGCAACATGACCAAGGCCAAGCCGTTTGTGATCACCGAGACTGGTT
GGCCGGCCGGTGGCTTTGACAAGCGAGCCTCCGAGGCCTCACCCACGAGTGCTGCGGTACGTACAGTAGCTCTTGCTGCATACCTGGCTTTTGTCTCGCG
AATCGCTCATCTCATCTCTTCTTTTCCGCCCCACAGCGATACATGAAGGAGTTCGTGACGTTGGCGACCAAGAGAGGCTGGAAGTATTACTACTTTGCCG
GCTTTGACACGCCCTATCGCAAGTATGTGGACAACCAGAAGAACTCGGTCGAGGCGTATTTCGGCATCTTTAATGTCACCGGCAAGCTCAACACGCACTA
CGATACCCTCACGATCAACGTGACGAACATGACGGACGGC