Description :
From Genome Similarity Track
Location :
Scaffold_19:1814880- 1819060
Sequence
4180 bases(100 bases per row)
TCGTCAGCAGATCTCTGATCCGGATCTCCCCACTTCAACACTCCTCCTCGCCGGCAACGTCAAGCATCCTTACCAGCGCTCTCATTTTCCACCTTCGCCA
CGTTGGCCTCTCGAGGCCTGATGCAGCCCCACTTCGACTCGTAAGTCGGCCATCCTCGGCGCACTCAACGACTTCGTCATCAAGTCGGCGGGCATATGCT
CGCTCTCACGGTAATCGGGGCCCAAAACGCCCTTCTCCGTGTAGGAGCTAACGAACTTTATACGCACATCAATGTGCTTTGCCTTCGCGCTTGCACTTTC
ACCCCCTAACTGCTTCAACGCTGCCTGATTGTCCACTCGCAGTGGCATTGGCTCTACGTGCTCGACGGCGAGTTCGCCTAGAAGTTCTCGAACCCCTAGT
AACTTGGAGGCCATCACACGATACTCCGCCTTCATCGTGGACAGCGATACACCGCCCTGCTTCTTGCAGGTCCAGCTGACAGGCATCCCATTCACAGTTA
TGAGTCCTCCGGTCACGGACTTCCTGTCCTGCTTGTCGGCCGCGAAGTCCGCGTCGCTGTACGCGACGAATTCCAGCGGCTGCTCCGAACTCCTGTCTCC
CTTCATCTGCAGACGCAGGTCCTTCGCTCCCGACAAGTACCTGACTATACGCTTTGCCAACCTCCAGTCTGCCATCGTCGGGCTGTGTGTCCGGCGTGAC
GCCTTGTGCACAGCGAACGCGATGTCGGACCGCGTGCAACGCGCCACCCACATCAAACTTCCGATCAAAGACTGAAACTTCGCCACAGTCACCACGCTAC
CGTCTCCTGACAACGGTAAGGTCTCGGCCGCATCCAACGGCAGGTCATTCCACTCCAAACCAATGGGCGTGCGCACCGGATGCGCCGCCTCCATCTCGTA
CTCATTCAGGATGTCAGTGATCGCAACCTCCTGATCTAGATCGAATCCGTTCTCGTCACCATACGTGACGCGCGTCCCCAAGAACTTGCTCACCACTCCC
AGGTCCTTCACAGACAGATCCGATAGCTCTCCAAAGAACGCGTTCACCGCGTCTTGGTCCGTGCCGGTGACCAGCAGGTCGTCCATATAGACGCCTACGA
CGACCAGCACTCCTTGCTTCCGTCGGTAGTAGACGCACATGTCCGTCAAGCTCTGTTTGAATCCTAAATCTACCAGCTTCTGGTGAAGCAGTTTGCTCCA
GAGTCGCCCAGCCTGCTTTAGTCCATACAGCGCTTTCTTCAGCTCGAGGACCAGCTCGTCGTCACTCGTGGCGCTCAGCTGCTTCTTAATTTCCTCCGAT
ATGACTATTCCCAGCGGTAGCCGAATGTAGATGTCCAGTTTCGGCTTCTTCTCCGCCTTGACGTAGGCGTTTGGTACATCCCCGTGTCTTACTGGGACCC
TCCACTTCCTGGTCAAGCACAGGATGAGCTTCATACTGCACATGTCGATCTCCGCAGCGAAGGTGATTCCATAGTCCACACCGAACTCTTACTCATTCCC
ACAGGCCACGAGCCGCGCCTTCAACCGTTTGATGCGTCCTGCAGCATCCTTTTTCGTCTTGAAGACCCATTTTGTATGCAGTGGACGCGCCCCACTAGGT
AGCCGCGTGACCTTCCACACTCCATTTTACTCGAATGCTTCGAGCTCATCTTTCATGGCTTTCATCCATTTCTCACGGCACTGGCTGCGCATCGCCTCTC
GGTAGCTCCTTATGTCTACATCCATCACATTGTTTACCACTCTGGTTTCTGGCTCCTCCTGCTGCACGGACTCGTCCGTCTCCTCCACAGCCTTACGCGC
GACCGAACTTGTCTCGTGACGCTCTCGCTGCCAGGTTTTCTTCTGCTTGGATAGTACCTTTCCCTTTTTCCGCGTCAGCCTTCGGCCGACGCGCTCTCAG
TGGTGGCCGCCTCAGCGGCGCTCGCAGCTCCACCCGTGGACTCGTCCTCAACAGCACTGTCATCATCCTGCAGGTACAGCCGCTGCACCCACTCGTTCTG
GGTCTTGTTAAGCGGCTCAATGCTCTTCACGTGTTGTATTGTGACCACCACGCGGTCCTTTGGCAGGTAAACTCTGTATCCTTTCGTTCCTTCTCCAATG
CCGACGATCATGCCCTGCTGAGCACGCTGCGAGAAATGTTTGCTCCGCGGGTCTCTATACACAGTACACGGGGTGCCAAAAACGACGATCTCGCCCGGTG
CCGGTGTCTGCTTCGTTAGTACCTTCAGCGGCGAAGCTCTGCCCGGGTTCGAGTTAGTCGGCGACCTGTTCAGAATGTAGGCCGCGTACAGTACAGCATC
CCCCCAAACGTTTAATGGCAGTCCACAGGCGAAGATCATGCACCGTGCCATGCTCATTATGGTCCGATGCATGCGCTCAGCCTTTCCGTTGCTGGCTTGA
TTTCTGGGCTCGCTCCGGACGCACTACGCCGGTCTTCTTGCAGAATAAGTCTACGTTTTGGTACTCTCCGCCCGAGTCCGTCCTCAGTACATGAATTCTG
CAGTCGAAACGCTTCTCAAAGAACGTGAGGAAGTGTTCGAACTGCTTGGCGGCATCATCTATCGTTCGCGCCAGGAACACTCTGCAGTAATTGCTCTTAT
GATCGACGAAGTTTATCATGTAGCGGTTATTGAGACGATCTCGCGGCGTCATCGGACCCTTCAAGTCCGAGCAGATTACTCCACCAGCTCGATCGATCGG
CGAGTGGTCCCCAGTATCTTTCTGCGACTGCCGGATCTCATCTGTTTCCCCTGCGCGCAGGTTAAGCAGTTGACGCGGTGATGGTCCGTGATGACGATGC
CCGAGCTCGGGTCCCGTGCAAGTTTCTCAACTGCGTCGTAGTTTAAGTGTCCGAACCTCTTGTGGAACTCCACCAACGTGTCTTTCTGCACGTCATCCGA
CACCATTGCGGCCTCGGCCTCAGCCCGATCAAGTGCCGCCATAATTACTCCCGACGAGGCTTCTCCTTTCCGCTCTACGACGGCGGCACGACTAGCTCGC
CATACCGCAGATCCATGTCAAATGCTACTCGCCCTCCGTCTACACCAGCAACGACGCGTCATCCGTCTCTGTATGTCAGCGTATACCCCTTCTTGTCAAG
TTAGCCGCAGGAGATCAAGTTGAGCACAATGTTCTCGGCGCAATGCACGTCCATGAGCTTCACGATCTGCTCCGTGCCGCTCGCCATGACGCGCAGTGTG
AGAGTCCCTTTCTTGCTGATCTTGAGTGGATTTCCGTCTGGCTGTACGCACTTGCCAAGTACTCCTCGACGTCATCCAGCCACGACGCATCGCTCACGAA
GTGCCGACTGGACCCGCTGTCCAAGATCCACATCACGTCGTACTCGTCCGACGTCTCTCCTACTGACAGCGTGAGGTCAGGCTTCCTGCCGCCCCCTCGC
GTCCGCTCAGGATATGCTGCGCGCAGATGTCCAACTTTCCCGCACTGATGGCAGGTGCGTGTCTCCTTGCCGTGGCGCTCGGCCACGGCGCCCACGACTT
CTCTGCCGAGATTCTTGTGCTTGGCAGGTTCTAATGCCCAGGCTTGTGCGAAGTGTGCCAACTCCTTAGCCTGCTGCAAGTAGTCCGCTCTTGTCCCATC
TACTTGGCCATTAGCACGGTACGCAAATCTGCGGACGCGTACTGCACGATGTTGTTCAGCACAAGGTAGTCTGCCCCGCCACCGCATGCCTCTGATACGG
CGCCCAAGTACATATAGTGCTCGGGCCACGATCTCTTGCCTTCCTTCGGCGCAGTGAGCAACTTCATTGCTTGCGCGGGGGTGATGTTGGTCTTATACGT
CTCGAGCATCCTCTCCATACGTATTGCAGTGTGGGCAGTTGTGTCCACCAGGCATCTACTTGCTTGTTATAGTACCTTTCTGCTGCCCCCGCCAAGTAAT
GCCCCAGCAGATCCACCTTCACATCTTCCGGCCACGCGAACCCACATTCTGACTGCGCCAGCGCAACTTGTCTCTCGAAGCGTCGACCCCACTCGAGGAA
TCCAGATCCGAGCCCCACGAACAACTCCTTGCCGTAGAATGGCCGGATCGCTAGCTTCTTCTGTCGCGCGTCCGGGTAGCGGACGCCTTGGTTCTGCTGC
TGGAAATGCTCGCCTCCAGCCTATGTCCGACCATCTCGTGGTGGCGCTGGTGCTGGTGCTGCCGGCTGCGCTCCTTGTGC