Description :
From Genome Similarity Track
Location :
Scaffold_14:181485- 184357
Transcript NameFunction/comments
g1189.t1RAW42994.1 hypothetical protein PC110_g884 [Phytophthora cactorum
g1190.t1hypothetical protein
g1191.t1POM57906.1 Hypothetical protein PHPALM_37524 [Phytophthora palmivora var. palmivora

Sequence
2872 bases(100 bases per row)
CGGACGGCTGCGAGCTCTTGTGGATCTCGTGGGCCACGTGCTTCAGGTCCGACGCCGTGTCCTTGGCCGTGCGCATGTCACTCCGCATGTAGGACGTGGC
CGTGTTCATGAAGTGATTGCCGTGGCGGCTGTCGTACTCGGAGAGGTTCGATTTCAGCAGCTTGAGGCACCTGGCGGCGTCGTCCGCGGTCTGGTTGAGC
ACCTTCTCGAGCGATGCGAACTCCTGCTCGGCGGTCACGTTGCGGTCGTTGGACTTGCCCATGCTTGCGTTGGGAGGTGTTGAGGTTGGTTCTTGGTGGT
GGTGGTGGTGGTGGGGATCGACTCGTGTGCTTGAGATCACGTTTCGAAATGAGCTGAGTTATGGCGGGCGAGTTGTGGCGCACTCGATCGGGCTGGAGCT
GGTACGTGAGGGTCGTCGTGGTGCGGGCTTGGACGAATAGGCAACGTCGATTAAAAGGCTAGTTTGTTGGCTGCCGACGTCTCCCATCGAGTGGCATCAG
CGGATATATCTTGGGACAGCTTGCGTGGCTCATCGGAAATGCGCACAACTGTGTCGCAGCAAGTGTATCTCGGTAAGCCCACCTCGCCGACTTGCAGCAG
CAGCAGCAATGGATGTCATGTTTGTGTATAATTTTACATGTGTATTTTGAAATAAGTTTACGGCTAATACATGTTCCCAACGAGCTATATAGTATAGCTG
TTCTTGTGCGGGTGGGCGAGGTGGAACGATTGAGCACAGTGTAGTGCGAGGCTCAGATGCTCAAGCTCTTCTCGCCCACGCGCTGAGGGCTCGAGTCGGG
CTTGATGCACAGGAAATGTGTCCGTTGAAGCTTTGAAGGAGAACATATCGAAAAATTGCTGTCGCACTGCGAGCAGCCACCTTTTTTGTGGAAGAAACGA
TATGGCTACTCGTTGGGCTGAAAATCTCATTACGCAAGGTGACCGCAAGAGCGAAGACTACACTACTGTTAGTGAACATCGGTTCGATCTCATGGGCAAG
TCTGACACTGGCATTGCCGCCGAATTCTTCAAACTCGAGCTACTGCTGATCCAGACGGCAGATGACGCAGTCAAGTGCGTCAAAGTGCTGAAAGCCAACT
TGGTCGAATACGATACTCACAACGGACTGCATTTCGTCAACACCTCGAAGTATTTCCTGATCAACAACATTCGTATTGCCAAAGATGCGGCCTCAAAGCT
CCGCCTTGTGTCGGATCAAATCGCCAAAAGCAAGTTTCCGTCGGAATGGGAGATCGCTGCAGCACGCAACAAAATGAATGCTGCCTCCGATGCCATGAAA
GAGCTGAAGAAGGCAGCTCGTGCCTACGACGAAATGAACGGGAAATCGAAAGGCATCACGCGCATTATCGACAATATGCTTGTCGGAAAAGAGAGCAAAG
GCGGAGAAGCTGCTGATACAGTGGAGTCAGTGGTGAAGTCGACACTGCGCAGCAACTTCAGCGGGTTTTCAGCTTTGAAGCATCAGATTTCAGGCGCAGA
GAAATCGCTTTCGCCCTCGATTGTAGAGCGAGCCAAGTACGCCGTGGTCGACGTAGTGAACAAGTTGAAGCCCGACTCGAGCCCTCAGCGCGTGGGCGAG
AAGAGCTTGAGCATCTGAGCCTCGCACTACACTGTGCTCAATCGTGCCACCTCGCCCACCCGCACAAGAACAGCTATACTATATAGCTCGTTGGGAACAT
GTATTAGCCGTAAACTTATTTCAAAATACACATGTAAAATTATACACAAACATGACATCCATTGCTGCTGCTGCTGCTGCTGCAAGTCGGCGAGGTGGGC
TTACCGAGATACACTTGCTGCGACACAGTTGTGCGCATTTCCGATGAGCCACGCAAGCTGTCCCAAGATATATCCGCTGATGCCACTCGATGGGAGACGT
CGGCAGCCAACAAACTAGCCTTTTAATCGACGTTGCCTATTCGTCCAAGCCCGCACCACGACGACCCTCACGTACCAGCTCCAGCCCGATCGAGTGCGCC
ACAACTCGCCCGCCATAACTCAGCTCATTTCGAAACGTGATCTCAAGCACACGAGTCGATCCCCACCACCACCACCACCACCAAGAACCAACCTCAACAC
CTCCCAACGCAAGCATGGGCAAGTCCAACGACCGCAACGTGACCGCCGAGCAGGAGTTCGCATCGCTCGAGAAGGTGCTCAACCAGACCGCGGACGACGC
CGCCAGGTGCCTCAAGCTGCTGAAATCGAACCTCTCCGAGTACGACAGCCGCCACGGCAATCACTTCATGAACACGGCCACGTCCTACATGCGGAGTGAC
ATGCGCACGGCCAAGGACACGGCGTCGGACCTGAAGCACGTGGCCCACGAGATCCACAAGAGCTCGCAGCCGTCCGAGTCCGAGGTCGTCTCCGCCCGCA
ACATGATGGGCGCCACGGCCAAGGCCATGGACATCTTGAAGACCACGGCTCGCAACTACGATCAGAAGAACGGCCGCTCGAAGGGCGTCAAGGGCGCGGT
CGACAACGTCGTCGGCAATAACGACAGGGAGGAGGACGAGAAGCACACCGGTCTCTTTGGTAAGGGCGACAGGGAGAAGGACGAAAAGCACACCGGTCTC
TTTGGCAAGGGTGACAAGGACAAGGAATCCAAGGGTGGTCTTTTCGGCAAGAGCGACAACAAGGACAAGGATAGCAAGCACACCGGTCTCTTTGGCAGGA
GCGACAAGGACAAGGATGACAAGCACACCGGCCTCTTCAGCAAGGGAGACAAGAACAAGGACGACAACCACGGCGGTCTGCTCGGCGGCAAGGCCGACCA
CCACCACCACGGAGGCGGCATCCTCGGAGGCGCCGACACCGTCGAGGAACTGACCAAGACGACGCTGCGAGA