Description :
From Genome Similarity Track
Location :
scaffold_47:181405- 182429
Transcript NameFunction/comments
Plaha_PHALS_00517hypothetical protein

Sequence
1024 bases(100 bases per row)
TTTTTTCTCGAAAAAAAGCGGCGGCGGTGGTTCTCTTGGGAACAACAATCCCACTTTAACAGCGTCGACGGACATTTTTGTCAATTTTGCATCTCTTATA
CGCCTGTGGTCAATGCTTGGTTGATGTTGTGCGACCTTTTGCATTGATGTCTTTCTTAAGTGTACAAATCGATCATCACAGCAAAAATTTGTGATCTTGG
CTCTCTCCGAGTCTGCACTTAGACTATGAGAATCATGTCTTTTGCTGCCCTTATTTTGTAACTCCGATGTGACTACAAATTTGTCAAGCATGTCCTGGTC
GCACTGCACACTTAGATCTTGTTTCAACACTCTCGTATCGCCGTTTTCCTTCTTAACCTGGCGTAAGTTCGTCACCCCAACTTGTTTCGCCTGCGATTCA
CCAGTTTTTTCATTCACTGAATTCGTCGACTGCATTGTTATATTTTCTTGGACGACTCGACGTGTAGTAGGAGTCTTAAATTTGTCCACCTGTACACCAA
GCGCATGCCTTAGATGAGGAGCTAGTGTATTGCCTAGACAGGACAGCGTGATAGTTCCAGTCACGCTTCCTACGCTTAAACTGCTGTGATCTCTGAGCTC
CCACAAACCGCTGTGACTCGCCCACTCGCAAATGTGGAGCAGATTGTCGTTACTCGATGTGTCATCATCAAGCAGGTCAGCTTTTAGAGCTAGAGGCACG
GCAGCaaaagctcgaagtcgacccCTACCGTGTTCCTTAGCGAGTATTAGAAGCGTCAGTGGTGCCTCGACATCTTGCTGCAGCTCGCGAACGAGCTCAT
TGGGACTTGCTTCAAATAAACACGATTTGCCATACTGCAGTTTAGTCACTGCAGGTTCATGAAGTCCATCCAGAGCTTCATTACAGGATAAAGTGTCGTC
AAATAGGACAATCTCGTACTGTAGCAGCTGAAAGGCAAGCAATAAGGGGACAGAAATTGGAGATGGCACTGGATGAAGTGTGACGCAATCTATATACATT
TGCAGCGTGAAGAGTAAAGAGGCA