Description :
From Genome Similarity Track
Location :
Scaffold_283:18140- 25594
Transcript NameFunction/comments
Phypl_g6425conserved hypothetical protein
Phypl_g6426hypothetical protein PHYSODRAFT_474510
Phypl_g6427hypothetical protein

Sequence
7454 bases(100 bases per row)
GTCTCACTACGAACGTGTTTTACTCACTGCTCCCTTGATCAACTGTAAGCGACTTGATGTCAGGTTAGTTGTCTTGTTTCGTAAAATTGGTTTAGGTATA
CGTTGAATATTGTGTATACCTAGCTTCTGCGCGCGATCGACTTGGAAGGGTTTCTAAGCCGCATCAACTTTTCTCATCAAATccgcagcatgagcagcaa
gGACGCGAGCGAGCCCAagacgcaggaggaggaggatctGGACGACCTCCTCGAAGGTAGACGCCCGCATCTCCGCCACCCACGCACCTGCCCACGCGCT
CACCTTCTCTCCGCGCTGTTGCAGATGCGCTGGACGACTTCGCGGACGAGGTGAGCGCCGCGCAGGCCTCGGAGACCTCGAGCGTGGTGCAggaagccgc
cgccactgccgccgcgACGCAGGACAGCGAAgacaacaagctgcaggaggtcgGAGCAGCTGCTCCGAGTCTGGAGGTGacaggagtgatggtctgACGC
TTGTGGTTAATGCCAGAACATGGCCAAGTTCCTCGAGGACGCGCAGAATCCCGAGTTccagaaggtgctggagcaggccTTTCGAGAGCTGGGCACGGAC
GGTATAGTGGAGTCAAGTCAGAGGCCTGTGAGGGAGCAGAGAGGCTGATGGTTTGTGGTGGGAACTTGGTGCAGCGGACACGGAGAACATCGGGCAGCTG
CTGGGGTCGTTGAAGACGGACGACGCGACGGACGAGACGGACGACGTCAATGCTGGCgtggccaagacgctgcagaacaTGGCAAAGGCCGCGGAAGACA
TGGAAGGAGTGGGCACGGCCCAGGTGGAGGCGATGGGAGAAGATATGATGGGcgagatgatgaagaagttcgagCAGATGGGGGAGAAGGTAACGTGGTT
GGTTGGAGGGGCTGGCTGGAGATGTTGAAGCAGGAGCAATAACGgacgacggtggtggtgggaTTCTTGTTACCTTGCAGAGTGATTTCCAGGACTTGGT
GGACGGtatgatgcagcagctgctgtccaaggaCGTCATGTACGACCCCATGAAGCAGATCTGCGAACGGGTACGCGGACGCGAAAGTGGATGTGGATTT
GTCGTTGGTTGGGAGAATAACCTTGAGCTCCTGTTGTTTTTGTGAAGTATCCTGAGTGGCTCGCCGAAAAGGAACCGCTGCTATCGAAAGAGGACTATGA
GAGGTCAGTGGTTCGTACAGTGCATGCTTGTTGTCTGTGTCGACCGTTATCGATAACATTTTTTGCGGATTATGGTATGCACAGATACGGCAAGCAGTAC
CAGTACTTTCAGCAGATCGTGGCAATGTATGAGTCGGAGCCCGACAACTACGCTCGGCTGTCCGAGCTCAtgcaggagatgcaggagACCGGTCAACCTC
CTTCGGAGATCGTGAAGGACCTTGCTCCGGGTACGCATCCTTTTATCATCGATATGAGAGCGTATGATCACTAAACGATTGCCCCCCTTGTTTCTCAGGC
TTGCAGTTTGACGACGAAGGAATGCCGATCATGCCCAACATGGTTTGTCTTGCGTTGTTTGATGATATATAGCACGTTATGGGTCTAACAGTGATCATGC
TTCTGTTTGATCCTTCTTCACAGGGCCCTGGCATGTTCCCCGGTATGGCCGGAATGCCTGGCATGCCCCGTAAGGCGATTATATTGCTGAATGTCTTCGT
TCTGTTGCTAATCGCTTTTCGTTGATGTGAATGTAGTTGGTGGTGCCCCAGGCCAGGAGCAGTGCTCTGTCATGTGATCTGACCGTATTGCGCATATTGA
AGATGACCGTTGTAGCTGGTATTCCTTCGTAACATTGCTAGAGAATTGCAACGCGGCTTTGCCTGTGGGTAGGTAGCCCTTCTATCTTGGACCTGACGCC
TGTTCATTCCTTGCTGCGTGGATCCACATCGCTACGAGCCGCGCGCAATGCAGCACCTTGATGCGATTTCCCTCGGCGTGTTTTCGTACTTGCAGGCTCA
CGAACGTGTGTCCCGTGTCGAATCAAAGCCACTTGTTGGGGCCACTCAAGTGGAACTTGGGCACTGGGAACAGGTATGATGGAAATGCTGATCTGACCAA
CCTGAATGAATCCTCACACCAGTTCAGAAAAACTCCCCGGATGTGCTTCCAGACGACTTGAAGCGGTTCTACTCTATCGCAAACGGGCTGTCGGTCAAGT
GGTTTGCGCCGTTCCGCGGTATGTTGGTCACAATGGCGTTCTCAAGCCTGGAGAGCAGTGCTGAAATTAATGCCAAGGCCACTTCATCCAGACCACTCCA
CTCTGGTGGGTCATTTCTTACTGAATTCGCTCCAGGACTTGCAGCGCCTCTCGATCAAGGACCTCCCATCCCAATGCCGCTCTACTGATCAGCATCGGCT
CGACTTGAGAAAGGTACGACTCGAAATCTGGCCGgctctcgtcctcttcgtcccTCTGTCACTTACGTTCGTCTCGAAACCTGCAACCAGATCAGCCACA
AAGAGCTCGTTGGGTTCTCTCTTGAGGCATCTCCGAAACATGGCACCGTCGTGCTCGTCTACCTCGATGGTAACTCGAACGTATCATTTTCTGGGGTGAC
TTATGGTGCTAAATTCGTGAATTCTGCAAGCAGAGGCACCGCAAATCTGGTTTAGGGACTTGCGAGGCAAGTGGAGCTTTCTCGCCGAGACGTTTACCAA
CTATTACCGCATGATGCTCACTCATCTGGGCATCATATCGTGGCAGGTAAGTAAGTCCTCCTTTTTTTAATCATGTCGCGTTGGCAAGGAGGCCCTCCAA
GCTCACATCGCAGTTGTGGTATGGTGCTATTCTTTCGGACAGACAATCTTCTCGGACACTGGCGTAGACCCCATGCGAAAGGTATGCACGAATTGGTATG
CGTGCACACGATCTGCTTGTAGTAGTATCTCATCGGCTTGCCATCCTGCCATTCTTCGGAAATTGAAACTGATAGCCATGGCTTCATCTGTTCATTCCAA
ACCGAATGCTTATTGATGAGCGAGTTCAAGGCGGCTCTGAAGATCATCAAGAATGACACACAGATAGGCAGATGATACTTCGGTACCTTGTCTTCCAGAT
TCGAAACTTTTCGATAGCATTAATAGCAGGTTAACGGCGTATTCATTGGGTTAGCCATCTGTGCTCAGACACAGTGAGTTTGTCAGGCTCACTGCCATCC
TCCAAGTAAAAGATACTCTCATCTTTATACTTCAGCTTGCCGTAGTCTTCCTTCGAAATCGCGACGACTCTTCTCTTCACCTGCGATGACGAGATATCGA
GCACTTTGACGGGAGTCTTCGAAAGCTCAGGGTTATACGGTTCACTGGTGGATTGAAACAAAGTGTACACACGGTCAGCCCCGTGCGTGCAGTACCAACA
GAAACAGCACATATGCGTACCGTTTCAGCATGCCGACTCGAAGCATCACGCGACTTTCCTTGCTATCCTTTCGTTTCGACTGAGAGCCTTCGTCTTTTCG
ACCGCTCACATGAATGCTCAGGATCTCGCAGACGTTAAACAGGAGGTAGTGATcagctgcgcttcctgaGATGTCTGCCATCACGAGCTCGCCGGTGTAT
AGTTTGAGCGTGGAGCTACAGAATTCAGGTCAAACAAGTTAGTTGATGGACCACAACGGGAACCGAGGAACAGATTTGAGAACATACTTGTCACTGTCAC
CGATCTCAGCGCTTGCTGCGAACACATCTTCGCTACCGACGCGCTGTGGCTCGAAGACCGGTTCTTCTGGATCCAACATTTTCTGAAAAACAACCAGGAT
TTTCAAATAATCAGACTCTAGGACCAGCCTTCATAACACTTGGCAGAGGCTTGCTTACCTGGAGGATCATGCACTCAGTAACCCACTGGAAATCTTTAAC
GGGTAAGTGGCGCTTTCTCTTGTAGTACCGGCATGTCTGGAAATTTCACAGGGAGATAACGCAAATGTTAGCTGTTAAATAGTAAAGCTCAGTGGAAGAA
TGTGAACCAGTACCACCTACCGGCGTATACTCGTCGCATAGCACCACATCAATGCTGACATCACTTTTACTGGACAAATTCTGCAAACACCACATTATAT
GGTTAAACTGACAGCCAGCATCACGGGTAAAATGGCCTTCAAAGAACAGCGGGCTCACCTCGTACACAGCGTCTGCGCCACAAGCTTTCAAAATAAACGC
CATCAAACTGGCCTTGTCCTTCGCCTCTGTCTTGGATATCTGAGTCATGTCACTGACGATACCAAAGGAGTAGCCTTCAAAAATGTGTAACTAGTCGTAT
ACGCATAAACACCAAAACGCAACAAATGGTTagtgaaaaaaaaattcCTCTCAAGGCACCGCACCATGCAGCAGTATTGTAGATGCTTACCTCTCTAGGC
GGGAAGCACTCGAACTTCCGAGTGGTAACGGAATAGCCTGTTGGTACTTGATACCCATCGAAAGGTATCACATACCCAGCCTCGATGCAATCTTTGATCC
AGTCTGTATGGACGACAGAGATTCCACACGCAACAGCTTGCATAAACTTGCGCTTTCTCCACGATACAGGTGTCGCGACCACTACTGCCTTGGGGTTGTT
TTTGTACAGGACGTCCTGGTAGCGCTCGGGGATTTTTCCTCCGTGCCCTTCGATCAGCTCCTTCAAATTCTCTTCTCCAGTCTTCACGAAACCCGTCAAG
CAAAACTCAAACTTGAACTTGAAGAGTGTCCGAGACCGTGAAGCATATGCACGCTGTGACGGCACTGGTGTCAGAATCCGTGTTCGTGTTCGAACATGCG
GCGTCGAGGAAGGTGTTGACTGCGTGGATCGAGCGCTGCATCGCGCAGGAGGTCGCGGCGTCTGGGGATCGCCTGCGTCAGATGCCACACCACCATCTGG
AGAAAAGAATTGGCGCTTTCGTTTCTTGGCTTTCGGGGTGGAAGTGATTTCGTTTGGGGAATCGGTAACTTCGGACGATATTTTCTGCTTCTTATTGCTG
GTGGGTAGTAAACCTGAAAGCGTCGAAGAATTTTTCCTCTTGGAGCTCACTTGTGCTTCGGTCGTTGCAATAGTGACCACGGGGGAAGCAGGATCGTCCA
CTGGTGTTGGCGTGGGAGTTAGTGTAGGCAGGTACACCGGGCTGATAGAAGACTCGAAAGGGCTGGGCTGTTCACTCCTAGAGAAGGCTTCTATCCTCTT
GGCCGCTGGCGTACCTTGACTGGTGAGACTTGCACTGAAATGCGGCTCACCGTCCTGTGACTCCGgcatggagaaggagaatTCAAGGCTGCGAATTGCT
TTCGTCTGAGAATCGGCCCCAGTGGTACGCTCGCTCGCCAATTGGTCGTCATTTTTCTGCACGACGTGTTGCTGAGCGGGTGAGTTCGGCTCTACGACAG
GTTCACCCTCCGTCCGCGTTTTACTAGGTTGAGTCGGCACACAGTCATCTTGCTCGTCATCATTTGGAGACTTTTCGGAAGCTTGCTCCGCATTGTCCCG
AGGAGAAACGACAACAACTGGGTTGGCATGCACTTCGGCTGAACCAGGCTTTTCCACGCGGCTGGGATTGACTCTCGGTGTCAAGTAGTCCTGCTGTGTA
GCCTGCGACCCTTCTCGACTCGTCACTTCATCTTCACTAGTCCGCTGGTAGTTCTTCTGATCCGGTGTGGGCGCAACGACCGAGCATTCTCCAGTCGAGG
ATGAAGCCTTCGCAGCCTCTTCGCTCTTtgtcttggcgtcctcgtcaACTTCATCCACAAAAGCCGAGTCTGCCCCGTAAGGTAGAGTTCCAGTATCGGA
AGGTGGATACACTTCTGTCTCCtcctcaagctgctgggtgcACTCCATTTCATCCTCGTAATCCGTCTCGCGATCGCTATCTTCCGCAATAACACTCATA
TCAAACTTCTCTCGGTCTCCTCCGTtcacctgcttctcctcctcttcctgtGCACCCGAAGATTTGGTAAACGCAGCTTGGAAAATCCGTGGGGCGAGAT
CCTCACTGTACTCCGAGTACGCGCTAACTCCAGGCAGCGAGTTCTCGCCCTGCTTCTCTTCCTGACTCTCTTCTACCTCCTTCCTTTCATTGCTTAAGAC
CTTCCCCTTGCGAGCGCGCCATGCCGTGTCCATGGCCTTGAGCATGGTAGGCGGCGGGCTCGGGgacctgctcctgctcctgtcCTCCTGCCCCCGTCTC
GGTCTCTTCAAGGGCGACGTCTCCATCAAAGCTTCTTTGCTCTTCACTGGAGCTTGAGCCAGCaacttctcgtcgtcctgcgtGTCTCCAGCGAACAGTT
CACAGAATGGGTTGCCCGCACTGAACTGCGCAGCGGGTCGGAAGCCATCGCCGCCTCTCGTGGCGCCCCCCGTCGTCGcgtccaggtccagcacgagcCG
GAGCGTCTGCTTCTTGTCCctgagctcctgcagcggcggcagcgccacgtcTTCGGCGCTAGGAGGCACGTGAAACCCTAGGAAGGCGCTAGGGTCTGCG
CTGCATTGCTGCGACTCGgcgaagctgtcgctggggcGCCGCAAGGGGCTGTCGAGCCGCGAGAGCGACACGTCCGACAGCCGGCACTTGTCCGGGGACG
CAGACACCTCCGACGCACGCCGCGGAGACTCCATCCGAGCGCCACAAGCCTCGCTGTTTTTCGGACCGTTAGAAAATGGCGCGGACACGGAAGCGACGTT
GACCCAATTTCCCGCCAAGGGAGACGTGAGGTACGTGAGGCACTGAGCAAGTCCAtccttattgacttggaGTTATATAGTTTGATGCGATACGGGACGA
GACCTTGGAACGAGGCGATCGCACCTAATCCGGTTGGCCACAAAGAGGACCccatacaaacgccaagtcagGCCGAAGCCGTGAGGACACCGCCTCGTTC
TGGGATGCCTTGTATGAGGGCGCGTCGCCTCAATAGGTTCTGTTTGTATGTAGGACGGTTTCCAGGTTGAAGTGAGCCGTTACGGCCAGCGGCATATTGT
CGAGACGTTGACACCCTTAGTTTATAATTGCGGATGGAGTTTATTATTGTTTATTATTGCGAATGGAGGGCGCGGCGACGTTGGGACGAGCTTTCCGGGA
GGTGGCGCACGCTCTGGCGAGCTCGGATCAAGATGCGGTGGGGCCTGCCACAACTGCGGGCTTCGTGGCCGAGTTCCaggtgctgacggagatGGAGTGG
CAGCGACTGGTGCGAGTTGGGCTGAGACTTGCGCCTGGTGCTGACGTGAGGGGCCTCTACTGCTTCCGCAACGTACCGGCGTTCGACGGACTGAcggtgc
gcgtgctgcgacTGGTTCAAGAGTCTCCGACCGAGCAAGATGAGGGGAGGCGGAGAGTCTGGAAGGTCCAGAACACGCCTGTGGTGATAAGGAGGAGAGC
GGAAGCGGAGGAGACCGGCGACTCGACCGTGGAGGAcacgccaccacgagctgg