Description :
From Genome Similarity Track
Location :
Scaffold_59:18133- 19179
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014178Similar to has1: ATP-dependent RNA helicase has1 (Schizosaccharomyces pombe)

Sequence
1046 bases(100 bases per row)
GGCTTTAAGAAAATGACCAAAATCCAGTCAAAATCGATCCGACCATTGCTCGCGGGACAGGATCTTCTCGGTGCTGCAAAGACTGGTTCGGGAAAAACCC
TGTCGTTCTTGATTCCCGCCATCGAGCTTCTCCACAAGGTGAAGTTCACGCCTCGTAAAGGAACTGGATGCATTGTGATTTCGCCAACTCGTGAACTGGC
GTTGCAGATTTACGGTGTTGTGCGCGAAATCTGCAAGTATCACTCGCAGACCCATGGCATTGTCATGGGTGGTGCGAATAGACGTGCGGAAGCGGAGCGT
CTTGTGAAAGGTGTGAACATTTTGATTTCGACTCCAGGTCGTCTTTTGGATCACTTGCAGAACACGAAGGCGTTCATTTACCACAACCTGCAGATTCTCG
TCATTGATGAAGCCGATCGTATCCTGTCTATCGGTTTTGAAGATGAAATGCGTCAGATCATCAAATGCATTCCGAAGGAGCGCCAAACGATGTTGTTTAG
TGCCACACAGACGAAGAAGGTTGAAGATTTGGCGCGCTTGTCCATCAAGGAGAAGCCCGTGTACGTTGGTGTCGAAGAAGAAGACACGAAGGCCACAGTG
GCCACGTTGGAACAAGGTTACGTGGTTACTCCAAGTGACAAGCGTTTCTTGCTTCTTTTTACGTTTTTGAAGAAAAACTTGAAGAAGAAAGTCATGGTTT
TTTTTTCGTCCTGCGCCGCGGTCAAGTTTTATGGAGAGCTTCTCAACTACATTGACATTCCGGTGATGGACATCCACGGCAAACAGAAGCAAAACAAGCG
TACGACGACGTTCTTCCAGTTCTGTAACGCAAAAACCGGTATCATGCTGTGTACGGATGTTGCCGCTCGTGGTCTCGATATTCCTGCTGTAGACTGGATC
ATCCAGTTTGATCCGCCAGATGATCCAAAGGAATATATCCATCGTGTCGGTCGTACTGCTCGTGGTGCTAAGGGCAAAGGTAAAGCCCTTTTGATGCTGT
TGCCTGAGGAGTTGGGTTTCCTGAAGTATCTGAAGGCTGCCAAGGT