Description :
From Genome Similarity Track
Location :
Scaffold_45:1813- 4674
Transcript NameFunction/comments
Physo_108933predicted protein

Sequence
2861 bases(100 bases per row)
CGCGCGGGTCGCGGCGCTCTGACGGCTTCTCCCGTCGCCGGCGCCGCAGCCCCAGCGACGAGGATACCTCCACACGCTCGCAGGATGCAGGCGACCACTC
TGACGTCGAAATTATCCACGACTTCCGCTCCAAGCGCGAGCTGGAAGCCGCCGAAGACGAGGCTAAGCTGACGCCCGAGGCGCGCGAGCGACTGCGCGAC
CGCGAGGAGCGCGACGCCTTCGCCGAGCGATTACGTCAGCGCGACGAGGACCGGACCAAGCGCAAACGCAAGGCCGACGAGCTGGAGGCGTCCGAAGGCG
CGGGCGGACTCACGCGCGACGAGATCAAGCAACTGGCCACGAGGGGGACAGTTGACGCTGGACAGGACGCGCTCGGGGACAAGCTGAGACGCCTCCGCGA
GCTGAGCAGGCAGGAATACCTCAAAAAGAGGGAGGAGAAGGAGCTGGAACTGCTGGAGTTCCAGCTGAAAGACGAGGACGTGCTCTTTGAGGGCGGCAAG
AGGTCCAGGAAGGAGGAGGAGCAGCTTGAGCTCAACCGGAGGATCCTGGAGACAGCCAAGGCCAGGTCCAAGAAAGAGGAGACCGAGGGCTACCAGATCC
CTGACTCCTATGAGGAGGTGGACGATGAGGGCAACAGGATCAGGAAGAAGGAGGATTTGCTGACGGACAGGTATGAGGAGGAGGAGGTGTTCCACACGGA
GCAGGAGGTGTGGGAGGAGACGCAGGTCAAGATGGCTACGAGCAGGTTCGGAGCCAAGGATAAACGCAAGAAGAAGACGGAGGAGGAGGATGAACTGGTC
TTTGACGACCAGATCGACTTCATCTCGCAGCAGATGCTCTCAGGGCATCATGTGAGTGACGAGGACGTCAAGGAAGCGAGAAAGAAGATGGAGGAGGCCA
AGCACCTGAGCATTCAAGAGGGAAGGAAGCAGCTACCTGTGTACCCCTATCGTGAATCGCTGCTGGAAGCGATTCGGAACTATCCTGTCATTATCATTGA
AGGAGAAACGGGATCGGGCAAAACGACGCAGATTCCACAGTATCTGCATGAGGTTGGGTACTCGGAGCTGGGCACTATTGGCTGTACGCAGCCAAGACGT
GTCGCTGCGATGAGTGTGGCTGCGCGTGTGGCACAGGAAATGGATGTGAAACTGGGCAATGAAGTGGGATACTCGATTCGTTTCGAGGACTGCACTAGCG
ACAAGACTGTGATCAAGTACATGACGGATGGTATGTTGCTACGTGAGTTTTTGACCGAGCCAGACTTGAAGTCGTACAGTGTCATGATCATTGATGAGGC
GCACGAACGGACCTTGAACACGGATATTTTGTTCGGCCTCATCAAGGATATCGCGCGTTTCCGTGATGATATCAAGATCATCGTGGCTAGTGCGACGCTG
GATGCAACTAAGTTCAGCGCTTACTTCGACGATGCCCCGATTTTTAAGATCCCCGGACGCATGTTCCCCGTTGATATTCTGTACACGAAGGCTCCTGAGG
CTGACTACCTGGATGCGGCCATCGTGACAGTCCTCCAGATTCACATTACCCAGCCCCTCGGAGACATCCTCGTCTTCTTTACTGGCCAAGAGGAAATCGA
AGCAGCCGAAGAGATATTACTCCAGCGCACCCGTGGCCTTGGTTCTCGAATACGCGAGCTGCTCATTCGACCGATTTACGCAACCTTGCCTTCGGAACGC
CAGGCTCAGGTGTTTGAGCCAACTCCAGAGGGAGCTCGCAAGGTGGTGCTGAGTACGAATATTGCGGAGACATCGTTGACCATCGCAGGCATCTGCTATG
TGATTGATACAGGCTTCTGCAAGCAGACGAACTACAACGCGCAAACCGGCATGGAGTCTTTGCTGGTGGCGCCAGTGTCGCAGGCTATGGCAAACCAGCG
TGCTGGTCGTGCAGGTCGTACAGCGCCTGGCAAGTGCTTCCGTCTGTACACAGCGTGGTCGTACAAGAACGAGCTGGACGAGAACACAGTGCCCGAAATT
CAGCGCACGAACCTTGCCAGTGTTGTGCTGCTCATGAAGTCGCTAGGTATCAACGACCTGCTTCACTTCGACTTCATGGACCCTCCACCTGAGAAGGCAC
TCATTCGCTCGTTGGAGCAATTGTACGCTCTCGGAGCTCTGAATGGCCTGGGTGAACTCACGAAACTTGGTCGTCGAATGGCTGAGTTCCCGTTGGACCC
CATGATGTCCAAGGCACTGCTTGCTTCGGAAAAGTTCGGCTGCACCGAAGAAGTGATGACGATCTGCGCCATGCTGAGTGTCAACAACTCGATCTTCTAC
CGACCCAAGGACAAGGCCGTCCACGCTGATAACGCGCGCCTGAACTTCGCTCGGGGCGGTGGCGGTGACCACATCACGTTGATGAATGTCTACAACCAGT
GGGTCGAGACGAACTACTCGACGCAGTGGACCTACGAGAACTTCGTGATCATGCGCTCACTAAAGACTGCGCGCGACGTCCGAGAGCAGCTCGAAGGCCT
CTGCGATCGCGTGGAGCTGGAGCGTACGAGCAACCGCAGCGACCACGAGCCGATCCGCAAGGCCATCTGCGCCGGCTACTTCTACAACACGGCCAAGCTG
GACAACTCGGGCCACTACAAGACGGTCAAGAAGGCGCAGTCCGTGTACATCCACCCGAGCTCGTGCCTCATCAAGCTGGAAGAAGTCCCGCGCTGGGTCG
TGTACCACGAGCTGGCCTTCACGACGAAGGAATACATGCGCAACGTGATCCCCATCAAGTCCGAGTGGCTGATGGAGCTCGCGCCGCATTATTATAAAAA
CAAGGAGGTCGAGGACGCTCGCACGAAGAAGATGCCCAAGGCGGTTGGCCGGGCTGGTTAA