Description :
From Genome Similarity Track
Location :
Scaffold_72:18128- 19880
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.35Glutamine cyclotransferase

Sequence
1752 bases(100 bases per row)
TTATCCCATAAGAAGCTCCAGGACGATCATCAATGCGTTCACGATAATAAGTGGCACTATACGTAGGTAAAGACAGCAATTAGACATGAGGAGAACGATA
TTGCATCAAGTGTGATGCTGAGGAACACAAGGACATACCCCGTAAGTACTGGACAGCAACCAGGAAGCCCACAATCTGGTTCTTGACCGTCATGCCCTGC
GAGGAATCGATCTGATCCCAgCCATCTACAGAATGAAACTCCGCGTTAGAACTGACTTGCATCGGTAGCGTACCAaGCTGACTCCcACGCCTCGCGTGGA
AaTGCCATGAGACCGTTCTTgCCATCGACACAGATCCTACTTACACTTTCGCAGGAAGCGCTTTtCATGGAGAATACACACGGCGTTCGTgaGCAGCAAA
CTGGAGAGGAAGAAGTCCcACAAGACGCCCATCGTCACGCGCCGATCACTTCGCTGTCTTGAGCTGCTTCGTGTCCCGCCCCAATGCGTTGgCGTCAGAG
TTTCACTTAAGTTAACCCTAAATTTATGTGAGCCAcACCATTTtAAACCCATTATTTATGTGTACCACGTCATCCGAGTCTCCATTTtCTGTCAAACGTG
ATgaCGATCGTCAGGTCTCCACGCGTtGGGATCcgCgTCATCATCGGCCTCTCCATCACCGTCGTCGGTACATCAGTCCTCCGACACGCTTCACACCAGG
TCCCCACGATGACACGGGCGTCGGCGACTGGATCTACGAAGCGACGCGctAAGGCGAaggtgaGAGAAACAAAGAAGACGCCAAGCGACGCCTCAGAACA
GAAGCCAGAGATGCCGCCACGCATGCACTTCCTGATCACGACCCTTAGCCTCGCATGCGCTGCAGTCGTCGCGTCGCTCATTTTCCCACACGTGCAATCG
TCAGTGTGGACGGAGTCGCTCGCGCAGCACCTGCAGCTATCCAATACCAAGTCCGTGCTtCATGCcGCATCCAAAAGCTCCACTGGGAAGGCACAAGTGG
AGGTGCTAGGCGTGTACCGACATGACCCCAAGGCTTTCACCCAGGGGCTACTAGTGGCCGAACAAGGCGATGAAAAGTTCTtcATCGAATCAACAGGGCT
ATACGGCGAGTCGACGCTGCGTAAGGTCGATATCGAGACAGGACAGGTAATTATCAAGTACGACCTCGGATCCGATCTGTTCGGAGAAGGAGTGACGCTT
GGCAAGAATGGCGACCTAGTGATGCTTACGTGGAAGAGCAAGCAGGGGTTGACGTTTGACTTGAGCGCGTCGTCTGGCGAAGGCTCAAAGTTTAAACTGA
AGAAGACGTTCAGTTTTGAAACGGTGACAGGAGAAGGCTGGGGAaTCGACTACAATGGCGAAAGCCTCATAGTGTCGGACGGTTCGTCAAAGATCATGTT
CTGGGATCCAGTGACGATGAAGGAGCAACGCCAAATCACCGTCACTTTTAATGGCGAGGAGGTGCCTCAGCTAAACGAGCTTGAGTTTGCCAACGGCTAC
ATCTACGCGAACATCTGGTATCAACCTGTAATCGTGAAGATCGATCCAAAGGACGGCAAGATCGTGGCTGTATTTGATTGCTCAGACCTCATGCAgAAGT
CAGGTGCGGCATCCGACCCCAACGCTGTGCTCAATGGCATCGCATaCGACGGCGACGAAGATGTGTTCTACGTCACCGGGAAGCTCTGGAGCAAGCTCTT
CAAAGTACGACTACTAGAGTGAATGAGCAGaGAACAGTACACATACAAAGAA