Description :
From Genome Similarity Track
Location :
Scaffold_115:18128- 19208
Transcript NameFunction/comments
Sapdi_VS20SDRG_16142hypothetical protein
Sapdi_VS20SDRG_16143CAMK/CDPK protein kinase

Sequence
1080 bases(100 bases per row)
ACGTAGTTGGACGGGAAGAGACCGACGTCGTCCGGCGCGCCATCGACGTAGCCCTGGCACCAGCCGTCGTCGAGGTACGCGAGCACTTGAAGCGTGTCGC
CAGCGCGCAGCTCCAGCTCGTCGGGCTCTGCGCCAACTGTATGATGCACTCAGAACGTAGATGTGCGTACCTGTAGGGACATAGTCGTACAGGACGCTGA
CGGGCGTCGACCCCGCCATAGCATCAACTGCAATCTGGGGGTTTCGCGCGTGTGTGAAACCAAGGTGCATTTCACGTGTGTGAAATGGTGAAAAATAAAA
AAGTAGCCAGCGCCGCCACCTGCACCAAAATTGACCTTGTGAGAAATGTCGGGGAAGGCTTGCTGACGTCAAGGATGCACAAACGAGTGGCGTGGCTGCG
ATGCTGTCTACATTGAGTCTACAGAGTCAAGGCGACATGGTTGAAACAACAAAGCTACAGCGACGTAGTGCCTTGATCCCCGAGGTGAATGGACTGTACG
AGGAGGAAGTAGCTTGCAGCTCCTTGCCGAGAGTACGACGCTGAGTGGACATTCTTCTCCTGAGACGAAGCGATCATCTGCAGCCATGCCACATCACATC
GTGACCTTGTATGGAGATGATTGGGAGGATGTGGCATCAAATAGTGTATGTAGAACAGAATCGCCGGCAGTGTTCAGTGCTGTTGCATTTGCACGCTGCC
CACAACCCGTTTTTGAAGGATTATTGTGTGGCGGGGCATGCTTGCGTGGCGTATAATGCCTGTGTCCATGTTGCAGCAATGGCTTGCGACAGAGGTCGCG
TTTAACACTATTTGACGCAATAGATCGTTGGTGGTCGCTCTGTATTTCTCACAGGTTCGAAACGGTGTGAAATAATAATAATCCGTCGGCATACAAATAC
CAAGCAACATTTATAAAAACACACGGCGCGTTACACCAGGATCGGGAAAAATACGTTGAACCCGCATTCTTGGGCTGGACTGCTCGCCGCCGCTGCTGCC
AGCTCGTCGCCGTCGCCGCCGCCACCTCGCCGCCATGGGATGCCACAGCTCCAAGCCCGACCACGTGGGCACGCCGGGCC