Description :
From Genome Similarity Track
Location :
Scaffold_440:18121- 19446
Sequence
1325 bases(100 bases per row)
CGCGCTTCCAGCATGGACGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGG
ACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCCTAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAACGAGGTCCCGCGTCGCGGA
TACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTTCAACCACACAAGCTACGAATGCCTGACTCCGTAAGCAAACGTAATAGATTCTTGACTG
CCACCAACTGTTTCGCCGTTTTTCGTTGGTGCTCTCACCCGTTTCTCTGGGATTCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATG
CAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACCCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGAATCTGGAGCT
TGCATCTTCTTCCGCGTAGTCTTACCCTTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAAT
CTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGG
ATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTC
AGCAGCGTCTTCGTCGATCCGACTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCA
CGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATTTGCGAGATTGCTGGATCCAGCTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCTC
GATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGC
TTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGC
TTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGAGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCC
TGTGACGGGATCTTGAAAGTTGAGA