Description :
From Genome Similarity Track
Location :
Scaffold_361:1812- 3487
Transcript NameFunction/comments
Physo_144973hypothetical protein

Sequence
1675 bases(100 bases per row)
GTACACCGTCTGAATTGTTCAAGCATGTACTGCATTTTGGAACAACAAATGGAGGGGATCCGACACTTGAGCACTTGGGGGAGAACCTGGAAGTGATTTA
TTATTAACCTCACTACATGAGGATGCTTTGATGGGTGGATCTGACTTGACATCCTGACAGATAGCTACAGGGCAAGCTGGATGTTCCAACACTTCCTCTC
CAGCGCTGGACGTAGCTTGCGTTTGCAATTGGTTCGAGTCCACCAAGCTTAAGTCACGACATGATGCGGTGCAATTCCACCTCACATACCTTACATTGCG
TGCACTCACGTTTTGTTGTCGAACAGGAGCAAGCGGTGGCCTCCGTGCTCGCTTTCCACCGCATCGTCGTGAGCAGCCTGCTCGTTTTCCTCCGTGTCGG
AGATGAAGCTACTGCCCGCAATGTTCATGTACGTCTCCGTGGACACACTGGTGGCCTTGATATCGACTTGGGCACGATGCTGCAAACCGCCTTCGAGTTG
AACGCCGTCATCTGCATGTTCGTGGCCGCTTCGAGTGGTCGAGTAAAACGCCTTCGCCTACATAGCTGGTGTCCTCCTCGATTTGCGCGTTCGCCTTGTC
CGCTTGTCGAATCTGGGCTGCTGACAATATCCGTGGAGCCGAAGCTTGTCGCTCGTCCACACCGTTTTTCTTGCCGCCTTCGCCCTTGCTGTTAAAGCTG
CCCATGACCAATGTGGTACTCGCTGTCTTACGTCGCCAGGAACCGCATGCTGGAAGAAAGCCTTTTCCTTCGCGATCGTGCATTGAACTATCACCCGCTT
CCCCTCCAAGAACATTCACTGCTCGCCGTCGATATTGCTCTACAAATGAACACACTCTAACAAACCAAATCCGTCAGTCCATCGACCAACACTAGTGGGC
AGTGGGTATGAGCCAAAGCGCAACACGATTGCCGTGTGCAATTTTCTTCCGAGCCCACATCTTTATGGGACTGCCCTCCTCGCATCCGCACGACTACTGA
ACGATTCTTATCTTTCAGCCTCGCCTCAGAGGACACTTTGATCCGCGGTTTTCGTCATCGCGAGCTGTGGCGTAAACTTGACATTTTCCTGATTACCGTT
GCCCGGTGGCTCTGACAAGAGTACTCGAATGGTTCGTGTGGGAAAGAAGGGTTGATTCAGGATGGCGTACCTGTGGAACGCCTGAGCATGATGGAGGAGA
TGCGGAGTATGGATGCCTGGTCGCGTTTGACCTCAACTGGCCGGAGGTGCGCAGCACCCAGTCCGGCCCCGACCTAGTCTGACGAAGGAAGACTGTGAAG
TGCCCGGTGAACGTATCCCGGAGAGCTACCCTTCTTGGCGAGGCCAAGGCATCCCAAGGTACTTCGAATCCTCAGCAGCCCGAGCGTGAAGCTACTCAAG
TGCACCAAGCCATCGACACCCTGAATTGTGCCACCACCATGTTGAAGATGAACATCCAGGATACTGCGACTACGAAGACCCCGAGTGTGACCCGACAACG
AGTTGAGGACCTCAAGCAGCGAGACCAAGAGGCCACTGAAGCTCGTGGAGTCGACGACAGCCTGGATGGACAACCGACAGCTCGAATGGAATGCAACTAC
CCCGAATGGCGGATGATCATCCTGAATGGACAACGCCCGGAGTGCCCAAGTGCCGATCATCCTGAATGGACCATG