Description :
From Genome Similarity Track
Location :
Scaffold_1237:1812- 2849
Sequence
1037 bases(100 bases per row)
CTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTCGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGGTGCT
GCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCATGGTGATCGTAAATGTATGTAGCCCTTGGTGTGTCTACACCAAGGTCGAGAAAGT
CTTTCGAACCTCTAACAGATGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGACACTTGTGTGTGTAACCCTGTACACANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTCAACGACGCCGTTGACTACGAGGACGG
CGACGTGGAGATGGAAGAGGGCGAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGT
GAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGCTGCTGTGGAACAGCATCAGAGCCGGGAGTTCGCCGCTCTGAAGCAGGAGGTGGCGA
TCCTGAGAGCTCAAGTCGCTCAGGCCTCGCAGACCGCGTCGGACATCTCCGTCGACGTGGGAGGTCGCGTCGCACGCTTGGCCCAGCGCGTTCACGCGCT
GGAGCAGAGGTTCGTTCCCACTGGGGCTTCCGCTTCG