Description :
From Genome Similarity Track
Location :
Scaffold_41:181157- 186399
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14739hypothetical protein
Phypa_INRA-310PPTG_14740callose synthase

Sequence
5242 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGCGTTTCTTCGCTAACTCTTTGTTCATGGACATGCCTGATGCCAAGCCAATTCGCAAGATTCGTTCGCTGACAGTGTCTACGCCGTACTACAACGAAA
TTGTCATGTACTCGATCAAGGATTTGACTGCTCAAAACGACGACAGTATCAAGCTGCTGTACTACCTGAAGACCATCTACCCTTTCGAGTGGGAGAACTT
GCTTGAACGTCTTCAGGCTAAGGACATGGAGGAGGCTCTGAAAAAATACCCGGAGGAAGTCCAGATGTGGGCTAGTTACCGTGGTCAGACGCTTGCTCGT
ACTGTGCGTGGTATGATGTACAACGAGGATGCTATCCGCTTCCTGCACTGGCTCGAAATCTGTGAGAACGAGGTCATGCACCAGTTTGGCTGCCCTTGCA
ACAAGTGTAAGCGTCTGGATGAAATGGTCGCTCTCAAGTTCAACTACGTTTGCACGTGCCAGATTTATGGTAAGCAGAAGGATGAGCAGCGGCAACAGGC
TGCCGACCTGGAATATCTGCTCCGCAAGCACCCAAGTCTTCGTGTGGCTTATGTGGACGGTCCGAAAAAGATGAAGGAGGGACCGCCCAAGTTCTTCTCT
GTCCTGGTTCGTGCTGACGGCGAGAACATTGCTGAGGTGTACCGTGTGGAGCTGCCGGGCAACCCGATCATTGGTGAAGGTAAGCCCGAGAACCAAAACC
ACGCCATCATCTTCTCGCGTGGTGAGCTGCTGCAGTGTATTGATATGAACCAGGATGGTTACCTCGAAGAGGCCCTGAAGATGCCGAACCTTCTGTCAAC
GAAGGACACTGAGACTGCCAAGGTCCCTCTTACGATTATTGGTTTCCGTGAGCACGTGTTCACGGGTGGTGTGTCGAATCTTGCTAGTTTCATGTCGATC
CAGGAACTGTCGTTCGTATCGCTGGGTCAGCGTATGCTGGCTATCAATCACGTGCGCCAGCACTACGGTCACCCCGATATCTTTGACAAGCTGTTTGCCA
TGGGCTGTGGTGGTACTGCCAAGGCTTCCAAGGGTGTGAATCTTTCGGAAGATATTTTCGCTGGTTTCAACAGTACGCTTCGTGGTGGCCGCGTCTCCCA
CGAGGAGTTCATCCAAGTGGGCAAGGGTCGTGATGTCGGTATGCAACAGTTGGCTCTGTTCGAGGCTAAGCTGTCTTCTGGTGCCGGCGAGTGTGTGATT
TCTCGTGATGCGATGCGCATGGCTTCTCGTCTCGACTTCTTCCGTCTGCATTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACACAGACGATGACGG
TTGTTGGTGTGTACTTTTTCATCTACGGCAAGGTGTACATGGCTTTGAGTGGCATGGACAGCTTCTTCCTCGAGAAGGGTGGTCTTGGTATTGGTGGCAC
ATTGAACACATCGTGGGCGTTCCAGTTCGGCTTCTTGCTTGTGGTGCCGGTTGTTGCCGTGGTGGGTGTGGAACAGGGCTTCCGTCATGGTGTTACTTAT
CTGCTGTGGAACATTTTGACCCTTGGTCCGCTGTTCTTCACGTTCCAGATGGGCACCCGTATGCACTACTTCGACCGCACGTTGATCCACGGTGGTGCCA
AGTATCGCGCTACGGGTCGTGGCTTCACTATCAAGCACGAGAAGTTCGCCGAGCTTTATCGTTTCTACGCGTTCAGTCACTTCTACCGTGCTGTGGAGCT
TATCTTCCTGCTGATCTTATTCCGTGCGTACGGCACGTTCTCGTGGTGCAACTGCTCGTGGACGCAGGATGCTCTATTCTACAACTACTACAAGCCTTCG
GACAATGACTGGAACACTCGATGCTACGCTAACTACTACCAGACGTGTGTTGAGCCGACCAACCAAAACTATGGTGTTATGTCGTACTCGCTGTGGATCA
TTGCAGCGACGTGGCTGTGGGCTCCGTTCTTCTTCAATCCAAGTGGCTTTGATTGGGACAAGCTGATCGAGGACTACAACGACTGGCAGAACTGGCTCAA
GACTACCAATGACTCGGCTGCTAGCTGGTCGGGTTGGTGGTCTAATGAAGTAGAGTACCTGGAGCACTCGACGAAGGGCGCGCGTATTGTGTCGATGATC
CGTAAGATGCGCTTTTTCTTCGTCGCTTACGGCTTGTACCTGCAGCTAGCGTACAAGACGTACTACGAGGACCAGGATCTGAAGATCGTGAAGGGATCCA
TTATCTCGTACGCACTGTCCGGTGCCATGTTTATCTTGGTGCTGCTACTGCTGTGTTGCGGCTACATCGCCAGTCGTGTCAAGAAGAAATTGACCTTCAA
GCAGAAGAAGCTGCGTAAGATGAAGTTCGTGCTCTCTTGCTGTGGTCTGCTAGTGGCATGCGCGAGTCTGTTGGTCATCTCGCTCATCAACTTGCTAGAG
ATCATCATCATCATCTTGATCGCCGCGTACTGGTTCCTCCAGCTGTGCGTCTACCGTAACCAGACAAGCCACGTGGTGGTGCGCGCGATGGCGCGGTCGT
ACGACCGGTGGGTTGGCTGGATCATTTTGGGTCCGGTGCTCTTCATTGCCATGTTCCTGCCGTTCCTTTCGTCCTTCCAGCAGCGTGTCATGTTCAACAA
CGCGTTCACATCCGGACTCGAGGTGTCGAAGCTCTTTGCGAACGAGGCGGCGTCGTCTACGAGCAAGATCGTCAAGGTGAAGCGTGTGGCCAAGAAGAAG
AAGCGAAGTGACTAGACGTAGCAAATCGTAAAGGCCGGCGTGGCATCCCAGTTGGATCGTGTTGGAATGGGGTCAAGGGTCTTCACAGACTTTTGGACCA
TTCCGTCACGCTCATGGTGCGCGCACGCCATCGATGGCTGGCGGTGCGGTGGCCTCTGCTTTTTCATTCCATGATGCTTTTTGTACGCATGCCATATCCA
GTATCTCATAGCAAAACAATACACGCCAGCGATGGCACTGAACATGCATTATTGTCTCTTTGATGAAACGTGCAATTCGAGGACAGGCAAGATCGTCAGA
GCGCAAATGAGCTCCTAGATCGCCACGTCCGTCCTCGCGATCAACGAGCTTCCGACGTCATACATTTAACGGAGCGGAGCATACATCGGTGACTGCAGCG
CAGCAGCGGCGACCTTGCGGCAAGCTCCATTTACAGCGGCAGGCACGTCGGAAGGACGGTCGTCATTTCGGGGCTGACGACGGAGTTGAGCGCTGTTGGG
TTGTATTACTCAGCACAAAAATTGTAAAATGGTCCGATTACGGCACGGCTTGTCTCACATTGCGCCCTTTTATTGGATCTTTTCAAATTTCATACGAAGA
TCAAGTGCAATATTTGGCTACACTTTTTTGGTCTGACTGACCAATTTTGGATTGAAATGGATCCTGTGAAAATTCGCGAGTGTCGTCCATCAAAATGATC
AATATGCCGTCAGCGCTGATGGCTCCTCAACGTCGTTGTTTGGGGCCCCTACACAACGCACCTTATGATTCAAGAGGGTCCATGATCGTATGGTCGAGAT
AACCTTGCTCTGCCGTTTCTCAGTTCCAGCATACACTTGGGGCGGGGCTACCCTGCCAACATTAATATCTCGACAGCAGTGATTCTCCAAACCAGGTTGG
AATCATTGATAAATAGTCAAGTTTTGTTTTTCTACTACACTTGTGTTCTCGGTCGTCTCGCTGTAACTGATGACGCCTTCACACCGAGTCGCCTTTCACT
GCTTTAGAAGCCCATGATTCCTACAAAGCACCGAGCCGAGTGGAGCGGCATCCTACTCACCACATGGGCCGCTGGCGTACAGCTTTTCTCGGCGCAGCAG
GGACCATGTGCACCTTTGGAATCGCATTTTGCCGATCGCCAGTTCGATTCGCAGCGTTTTCGTCCCAACTAGGTAGGGGTAGGTATGATCGAGCTGGCTC
CCTCTCTGAGGAGTTTCCTTGGCCCCCCGCGGAAAAGGCGACGCCGGCAATATCCAGCATTTCTCTGCCATCATTTCCAAAGGCGATCGCTGCCGGGCTG
TGCTTGTTGATACGAAAGACGAGCACAGTAGACTCGCGATGAATCGCCGTGGTCATGGGAACGGCAACGGCAGCGAGCGCGAGGGCAGCTCGGTGGGCCT
CATGACGGAGGCGCTCGAGATGCAGCGCCAGATGTGCGACGAAGCCATGAGTCTCGTGAACGCAGGCGTGGCCATGCAGAACGCGTCGCCCCCTAACGTG
GCCGAGGCCGAACGCAAACTCACGCGCGCCGTGGACATCATGGAGCAGGCGCTGAGTATCCGCTACCGCTCGGCGGACGAGAAGGACGCGGCGGATCGCC
TCAATAACAAGATGATGCGTTACGTCAAGATGATCAAGAGTCAACGCGCCAAGAGCGTGGTCGGCGGTGGACCAAAGGGACGCAACCTCATCAAGCACAA
CATCCTCGAGATGGAGCGACTCCCCGAGGTCTACACGCCTGTTCTCCAGCTGCTTAACAACTCGAACCAATTAGGCGACATTTGCGAGTCGCTTAAGCGC
ACTTTCGGCTTCCAGGAGAGCAGCGTACTCAACCAAAAGGAACACTTATTGCTGTTGCTCACCAACTTTAAGGAGCAGAGTGGCCAGGACGACGGCAAAA
AGAAGAAGAAGAAAAAGCAGGACGACACGGAGACTATTGACGACTATCTTCGCCAGCGCGACCCGCAGCTCGAGATGGATCTGGCCAATAAGGGCGTCAC
GCGTCTCCATGGACGTGTATTTGCCAACTACAAGAAGTGGTGCAAGTACGTCTCTCAGAAGCCCAAGTTCTCGAGCGATCCGCTTGTGGACATTGCGCTT
TTCTTCCTCATTTGGGGCGAGGCCGCCAACTTCCGACAAATG