Description :
From Genome Similarity Track
Location :
Scaffold_48:181129- 186240
Transcript NameFunction/comments
Hyaar_Emoy2806290hypothetical protein

Sequence
5111 bases(100 bases per row)
CGATGACGTCCTCGCTGACGAAAACAACGTTAAATCCACAGTGCCCACTAAGCGCACTTGATCAAACAAAGCCGAGCCAACAGATGAATTTCTGCTGACT
CGAGAAGCAGTGATCCGTTTCGTATAGCTCTCCATCGCTAACGCGGTGGACCGACAGAAACGGAATACTGACAAGAATGGAAGATCAAATGTGCTTCTAT
TAATTAGTCACCTAGTCCTACTGTCTACGTTTAACCTACCCAGACATGTATTGACTAACGTGGGTAGTAGTTTACTAATACCCAAGTACACTGGGCCCTG
TCATGTAGTGGACCACCAAGGCAACGTATACACGATCAAGCAGCCCCATAGGATGCGTATGCTTCCTACGCTTTACGTGGGGCGTCTTCGCCCGTACTGT
CGGTACGTGGTCTCTTCCGAGAGCAAAGACAGACCCCCCCGAAATGCTCAAGAATCCCCCAAAAGATTCTTTTGGTCGCGGACCAGAATCTGATCCTGGT
CGTGCAACGTCGCAATGTCACGACGAGCCAATCAAAGTTCGTCGCGGAGGGCTCTATGCTCCCGGTCGTTCTCCACGAAGGAGAACGCAAACTGCGCTCG
GTCATTCGACCGATCGACACGGTGAGATTAAACCGTCGACGTCAAATCGTGATGTCGATTCCGTTCGTGTTCCTCATCCTCGCGCAAGTCGTCGAGGATG
CGGTAATACGCAAAAACTTTGGACGCTAAGTCCGCAAACTGAGTCTGACTCAGTTTGCCCTCCTCCACTTCAGTCGTTAGTGGATTCGCAAGGTGGTTAA
AGATTTTTACGTGGAACATATTTTGATCTACCGTGTCGAGAAGGGGGGCAGCGAACGAGATATCTCGTTCGCTGGTACGGTTATCCGCCATCACACTACA
GCTGGGAGCCTCGCTCTCAGCTAATGACAGATGTTGCTGGCCTCATCGAGAAGCTCGACGAGGCTCATCCGATGGTCAAAAGGACCATCGTAAAAGGAAA
GCCTGAGGCGCTTATAGAAGGATTGCAAACTTGCACTCACGTCACGCATCTCGAACGAGATGGGATGCTTTCCCAGGTCGAACTAAGAGAGTATAGTTTT
CTCTCAGCCCGCATCGAGTTGGCTATACAACTCGAGCACGCGTCACCCCACGCGAGGCATGGAATTTTAGCTTTACGCACTAACTGGTGGAGCTTATTCG
AGCCCCAGTTGAGGTACGCATTTTTTAAGCCTAATACGAGCCGCATTAAGTTTACCCAGGTAAGCTTAACTCCCAACGTTTAACACGTTTGAACAAAGAC
GTTCCAAGGTTGAAGCAGCGATTGTTTATCGCGCTTTGTGGTTACCGTTGTTTGGGGGAAATATCGAGGTAGAAGTCCTCTTCAGCGATAAAATCTTTAT
CACTGTGCTGCAGGACAGTGAAGCCTGGAAGCATCGAATATGGTATTCGATAATGTTCACTTGTCTCATCAGACAAGCTGTTAATAACAAGCTCTGGCAG
TCGCCAAGGCTTATGCTCAGGGGCTTGTCGCAACGTTTTGCGATCAAGAGCCTCCTGAATAATACCAACAGAGGTACTTGGTATCACTGTAATGACGATG
GCTCGCGCCATCGTCGTAATTGTTGACATCGCGCACTTGTGAGTGTGTATGACTCGACGTAGGTGATGAACCATCAGAATCATCACCATCAGACCCAAAG
AGAGACTGCTAGAACTCACTTCTCTCGTAGCGTGGGTGAGTCTTCTTTTCGAAGTGCTACCAGGTGTAACGGGGCACACCTTATTCAACTAACTGAATAA
ACCTTGCACTGCTGACAGTGCAAGGGTGTATGCTTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGTTATACGGAGTACGAGTACTCAGTAA
AGGTAAAAAGTGGAACTGTATTTAGTATAGCTAATCCTTGTAATAAATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAACATGTATTATAACTA
TCTGCGCGCCACTCGTTGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGACATCTTGATCCTATATCAACCAATGAACAGTGTGTTACATCTGCGGGA
CAATATTATCTATTAGGATAATATTGTGAGAATATTGTGTTTGTCCTAACGCACTATTCGTATTTGATGTTTACCTTAAGTATATTATCATGTAACGGAG
GCACCCCGTTACAGCCCCCCTTAACCATCAGTCACACTAGTGAACGATTGACGATTGAATGACACTGTTGAGTGGATCTGGGACAGAGAAGCACTTGTTG
GTCAATCCATCCCTTCTTCGTTCTCTTCGCATGGTTAACAAGTCCATGCGGTGTGCAGCCAAAGCTGCTGAGAACGCAGCCATGAGACTTCGCTTTGCTA
CGGCAGGAGAGACAGGAACACCTGAAGCAGCTGACGTAAAATCGTCTGCTGCTTCCGCGACTCAGTCTGCAGCAGTCGCTGCTGCAGGCGCACGCGGTGA
TACACCGCGTGACATCGGAGATTTTGAGCTTGAGCTCATATACTCTGGCGAGTCTGATGGTGAGACCGACTCGAAGGAGGTGAAGCCAAGGAAGAGCCAG
AGTTGGCTAAACCGGAGCCGACTAAGTCGGCTTCTCGAAGCGCTTTGAGCCTTGCAGATCATCGTGACATCTTCGGGTCGTCCGACGATTCCGACCCTTC
GTCTCCGAGACGGAGTCGCTCTACCGAAAGCGAGATAAGTTATCGGAACGATCGTGACGGTGATGAAATCATGCATCATAGTCCGAGTGATCGGGATGAT
CTTGGTGTCGGTACTTCTATTGACACCAGACAGGATACTGTGGATCGCAACATCTTGCGTGTTGCTCCTGAGAAGAAGCCGTGGCTCCTCAGAGAGTGTT
GGCTTGTCCGTCTGACACGACGAGCGATCGTTATCAAATAAAGTTATTCTATTCATCAAAGCTTCATAAAACTGATCCTAGTGCGAGTAACTTTCGCACT
GAACATGATTCTTCATCGATGTGTTCTTCAAGCATCGATGGTACAGTGGAAATCACGAGCGTGATGGTCCCTCTTTGATTCAGGCATGGAACGCTTTCAT
CTACAACGTTGGTGAGATTGGGCGTGATGCCTGGCTAGACAAGCTATTGCTAGCCTGAAATCGTTTTGAGAAACGGACCTCTACCGGTGCACGTTTCAAA
CTGCATCGGTTGTTAAGAGAGGCCGGGCTACCATGCCTCTCTTGGGGTGATGCGTGCCAGGGTTGTGCGAATAACTTGGCACGAGCTCCAAGGAAGCTTA
CACGATGAATGAACCCTGGTGGAGGGTACGTGTCACTCAAGAGATGTACGAGGGAATAGCTAATGTGCAATCCCTCTACAAGAGTGCTGGGCGTTCGTTC
CCCGATGGGCCTTCTTCGGCATCGGATGCGCCTTGTCGTACTGCTCGACAAGGCCCAAAACATCAACCAGCAGTTGAGAGCGAGGCTCCCAACTATATGC
CGAGGTTGGATACCCGCGCCACCGGACGAGGTAACTCTTCCGACGTCCCTTCTCATCGCGGTGGTTCAACAAGCGCTCCACGAGAAAGCGTTGGCCACCG
CGCGCATCAATCAATGGATGAGGCAGAGGAGGAAACACGTTCTCAGACGGGTCTGCAGGCTCAATCTGATACTGTGAGCCAGCTCGAGTGCGTAACGTGT
GAGTTGCGCAACGATCTTGAGCACGAGAGGAGCAGAAGTTTGGGTCTGGTCGACAATGTGAACCGTCTCTCCTCGGAACGGGAGAGAGATCGATCAGATT
TTGCGTTTGCTCAGCTTGAAACGAGCTGAATCAGCGTTCTCTTCGCGATGAGCTAGTGGAAGCTCGTCAGGATATCTCTTGGCTTCGCGGGGAGATATCC
TAACTTCAGACTCGGGCTGATAGTCAGCACCGCGAGCACAAGTATCTCTTGGAGATGCTTGAGCGCAAGGGATTTCTTCACCGGAAAGAAGTCCCGTACT
GGTGATAAGGTCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTGTGTGCGTTGCCTATGCGGCGCAGCACACA
AAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTCACCTTCAT
TGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTTCTTTTGTCGGTCCACTGCTTCATCAATGGGATCTTGCACGAAACGGACAACCGTTT
CGCGAGCCAGTATGAATTCATCTGCTGAATCTCTGTCTTTGGCTTTAGTGCGCTTGGAGCAAGCTGTGGCAAGATCCGTGACCTGGGTAGTAAGAGCATC
CTCGCTCTTACTTTCCTCTTCTTCACCGAAATCGATGTGATCGACATCGGCGTCATACGTAGTGAGATCGTGGTCAGTACGTGATGAGTGAGAGCCGACT
TGGCGTTCGCCCGAATGAGTCCGTCCCCCCCTCAACTAGAGTTACACTCTAAGAAGGTGTACAGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTA
TGCGTCATCGATGCATGCACCGAGTTGTTGATGGCGAATTACACCATTGGCAAGAAATCGCTCCAATTCGTAAACGAATGGACGTAACCCCGAAGGATTT
CCTCAAGAACGCGGTTGGCACGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGAGTTCCGAGTGTTTTGAACACGGATCG
CCAGAATTCAGCAGTGAACCGTGGGTCTTGATCAGAGACGAGTTCACGAGGCAACCCATGAAGTCGAAAGATCGTGTCAATAAACCACGAGCATATGCCG
ATGAATGGTAGATTCAGGTACAGCGACCAGATGTACCGTTTACTGAATCGATCGACGAACACAAGAATACCTGTATTCTTGTGTGGGTCTGCGGGGAATA
CAAAGACAAGGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGGAGGACCTGACTTCACTTTTTGACA
TACTTCGTATG