Description :
From Genome Similarity Track
Location :
Scaffold_61:181095- 182680
Transcript NameFunction/comments
Phyra_81589Hypothetical protein
Phyra_81590Hypothetical protein

Sequence
1585 bases(100 bases per row)
CCGAACTCGTGTCTTGGGATTGTACGGATGCAACTCGTCCTCGTCGACGCTGTCGGTGACCATGACAGCGCATGGCCGTCCTCCAATCAGCTCATGGTGT
TCGTAAAATTTGTCGTACAGCACCTTGTTCGACTCTGTCACAATTCCAGTCGGACGAGCGGAAATCAGACGAAAGCTGCCGATCGACTCGTCCTCTCCGA
TCGTGTCGTAGTCTTCCCGCACAGTGATTTGGCCCAGCGCCTCCGTCGTACTAATCTCCACATTCGTCAAGAAGAACTTGGCTGCATTGTACACTTCCCT
CAGAGACTTGACTCCCACCAAGTGGCTCACTTCGAATCGTTCGCAGCAAAAGGCACCCGCAGCATCTTCGTAGCGATTTTCCGAGCTGTGTTTGGTTAGT
AGATTGAGGTGCTGCGAGCGCGCGAGGACGTATGGGAGCGCCGAATTGAGCTTGTCGTCTTTCATATCCACCAGCAGCTGCCTGCGTGTCACCCAGCACT
TTGGCAGGTGAACGTACGAGTACAGAGGATTCATAACCTGTCCCTCCTGGATAACCAACAAGGAAATAACGGATACCATGTCAGATCAGCTTAAGAGTAT
AGTATAAGGCTGCCAAGCGTTGGTGGTGCACCTGATAGTCTATGAGCTCGGACTGAGCGCCGGCCAGGACCAGTATTTGGTCGTGAATTAACTCTTGCAG
TGCATTCTTGGTGCGCAGCGAGCGCCACAGCAGCTGCAAATGGTCACTCGGAGTCATTGCCGCCGCTTCCGCCCGAGCGTTGAGCTCTTGCACCTGGTCC
TACAGCGCCCGAATCTGCTCCCTAAGCGCCTCTGCCTCCTCCCTCCGCACTTGGTTCGTCGACTTGCGCTTCTTCGCTGGCATTTCGGACAGCCTTGAGC
TTCTGGCACAACGTTTCGGAATGATGGCGATTCTTTTTAGCCGGTATTATACATGTTACTGTACTGGTTAACAGACTGGCTTCTGTTGCAGTATTTAAGA
CTTGCCTACTGAGCAAGCTTGCATTCTGGAGTGACAAGTGCGTTGTCGAACACGCGAGAGACGGTCTCCAAGTCGCCCAGTAAGTGCAGCATCGGAGTCA
AAAGGTCCGCTTTTGACTGCACAAGCTTCACGCGACTTGTTATACTGTCCCACTTGAAATGGATCGAGCCTCGCAGCACAAACCGCTGGTCGAGCAACTT
GGCAGCAACCGGTGACCACTGATCTCGGTCTCCATTGTGGACGAGATGAGGGAACGCAAAGTGCAGCGTGTTGGCCGTGATGGTGATTCCAACTGTAGTG
GTGGCGGTTAGCGAGTCTTCGGGGCCGGTATCGAGTCGCACGAGTTGGGTATCCGAGTCTGGCAGGTAGAGAGCGAGGCGTCGGTAGTCGTCGATGAGGC
TCTCAACGCCAAACCCCGTCTCGCCAACCACATCCGGCGATGTCGCTGCATGCAGGAAATCGTGTTGTACGCTAGAAACATTGGTGTTCGGGGCCACTTT
TGTGCTGTTGTCGGGGTCGTTCATTAGGGCGGATCCTTTCAAGCCGTAGCGGAACAGGCGAAAGTATTCTGCCACCACCGACAAG