Description :
From Genome Similarity Track
Location :
Scaffold_9:181046- 183486
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03509PREDICTED: uncharacterized protein LOC101499411 isoform X2
Sappa_CBS223.65SPRG_03510Hypothetical protein
Sappa_CBS223.65SPRG_03511actin

Sequence
2440 bases(100 bases per row)
CAAGTGGAAGTGCTTTACGTACCCCCACTGGTCCTCGAGGCGGCCACCGCGCTGGCGTCGCCCGTGCGCCACACGCCGCGCGAGCGCACGGTGACGTCGG
CCTCCAAGAGCAAGGACAAGCACAAGCCCAAGCGCCGCCACAGCGCGTGCGTGAACGATCTCCTCACCAAGCCCGTGCTCGACGACGGCGCCGTCGCCTA
CACGTCCTTGTCGCCGTCGCGGTCCCTGAGCTTTGCCGACGTGGTGATTGGCAAGTCGACCGAGACGCCGCCCGATGCGACCCGTGACGACGACGACGAC
GACGAGGGGTAGACGAGATCGTCGTGTGTGTATTATGCCCGACAGTAGATAAAGCCCTGGATCCAGCAAAACATACAGAATAATGTGAGATCCCAAGAAG
GGGTCGGTGCAGCGCCATACCTCTTTTTCACGCTTGCGCTTGATCTGCTCGAGCTTCATGAGCGTCTGGAGGATCTCCTTGCACTGGATGACCGTCACCT
GCGTCGCCTTGACGAGGTCGCCAATGGCCCTAGCGTCCAAGTTGTGAAGCGGACGACAAGTGATCGCACGTACATGCCCCGTAGCGAGTCGGCGAGGACA
AAGAGGATGCGCTCGACCTTGTTCATCTCGGACGGCGTCTGGTACTTTTTGGGGATCTTGGACCGCACGCCTATGGCCATGACGATGCTAAGGACGGGCG
GAGAGGTAACGAGGTACCTTTGGGCCAGTTCCAGGTGCGGGATGGCGGCGGCTTGGGCGCAGACTTCGCCGCCTTCTTTGGTCTCGGCGCGTCCGTCGGC
GTCGTGGGGCTGGCACTCATGACAGGCGCGAGGACTGGAATCTTGGACGGCGGCGGCGCCTTCTTCTTCGGCGGCTCGATGCAGGACTGCTGCAGCGAGA
TGCCCGTCATGAGGCCGCCGAAGCGGCTGTTGAAGGTCACGATGTGGTTGTTGACGGCCGCGAGCTTCTTGACGTTGGCGTCCAGCGCCCGCATCGCGTT
GCGGATCCGCCGCATCTCCCGCTCGATCTCGGGCTGCATATTTCGTCAAGTCCGTTTATCCGGATGTGCCACCCACGGCTTGCCGCCAAAACAATACCAT
CAAATTCAAATTCAAATGATCCACCTCGGGATCTCGCAGCAGCCGCAGGGGCCCACTGGCCGTGGCGGCGAAGGCAGTAGACGCACGAGCCCTGTCACTG
TGTTTTCTGTCAGAGGTTATCGAGAGCAATCGAGCCTGGCTATCATTCCTCGCTTAGGGACACTTCTTCTGGACGAGCGACGCGCCGTGCTCTGCGTACT
CAGTCTTGGAGATCCACATCTCGTGGAACGAGCCGAGCGACCCGAGGATGGAACCGCCAAGGAACGCGCCGAGCTTGCGCTCGGGCGGCGCGGCCGCGAT
GAGCTTGACCTTGTACGGCGTAACCATGGCGGAGACTTCGCGCTCGAGGCGCGTCGGCATGTTCTCAAAGCAGGACGAGCCGCCGGTCAAAATGATGTTT
TGCAGCAGCTCCTTCTTCGTGTCGGCGTCGCCCTTGGCCGCGCCCTCGCAGATCATGGTCGGGACAAAGATGCCCGACGACATGTCGACAGCATTCGACG
TGCGACTCGACGCCGCAGTGTCGTACGCAAAGTAGCGCTCCGCGACGCAGAAGCGCTCGGTGCCGAACGCGACTTGGGTGCCGTCGGGGAGCTCGTACGG
CATCTGCGGGATCTGCCCGTTGGCCTTCTCGTCAAAGAGCGTCTCCGAGACGCGGCAGACCGTCTCCTTGATGTCGTGCAGCGGGAGCGACGCGAATGCG
GTCGCGGACGGCAGCTTGGCGATCTTGTCGTCGAGGCGGGCGCGCAGAAACGCATTGAGGGCAGCGCCGCCGACGGGCTGCCGAATGGCATTGTGCGCCT
GGACGTAGCCTTCGAGGACGGGCACGACCGAGGTCGCGCCATGGCCCATCTCCACGACGAGGCCCGTGCTTCGGCCGTTCGCAAAGCACGTGAGCACGGC
CGCCTTGGACACAAAGTACGCGGGCGCGTCGTACTTTTCAAAGAAGAGCTCCGCGAGGGCCTCGCGATCGCTCTTGCTCTCGTTGGAGGACGTAGAAACG
TTGTGGAAGCTGCTTTCGCTCCATAGCACTGGGTGCTGCCCCGACGACTCGACGCCGAGCCGCTCGTAGCCTTCGTCGAGCGCAGCCTCGAGCTTGGCCA
TGGAGGCCACGTGGCCGTCGGGCGTCATGACGCCATTCGTGTCATCCTTCAAGATACCGCTTCGAGGACCGACGTACCGGGCTGCGTCCTCGCCCGCGAA
GCCCATGCGGGCGCGGTAGCTCCCAAAGTCGCAGACAATCGCATTGAGCTCATCCCCGCCGCAATACATTCTTTCCGCACCGGCCGAATCGCGCAAATGG
CGTTCCTAACCGACGCCTCACTGCGGCATTGTATAGAATA