Description :
From Genome Similarity Track
Location :
Scaffold_226:1810- 4075
Sequence
2265 bases(100 bases per row)
TCCCCAGATTACTTGGCTGGGGGTCAAGAAACCTCCAGCCAATCCCAACTACGGTAGGACGCAGCATCAAAGTAAAGGACACGGTTCAAGATCGCGAGAC
GGCTCAAGTGGTCAAAAAAAAGGTCAAGCGGATCAAGTATCTACATTTGGACAAGGCAATCTCAAGGGAGATTCGCGCAACTCGAATCAAGTCCCCCAGG
AAGACCGCGATCGCGTAAAAATTTCCACGTGATCGCCCACCCCATTCCAACTCAGTCAGCTTTCCCCTCAACACGAGTCCACCGAAAAGAGTTGAACCCG
CTCTACTGACGGGTACATAATGTGAGGATGGAAACAAGCACGCAAACGGAGAACCCCCTCTGAAAGTTGGTCGTCTGGTCGCTAGAGGATAGTCGGTATC
GCATCGGCAGCTTTGCGAACCCACTCCACCACACCCTTATGAGTTAGCTGGCCGCAGTGGAGTACAGGAACACACCACCGTTACCTGCGCCGACAAAGAA
CTCTTGGCCAAGTAGAATAAGCACTGGTACTCGCGGTAACAGTGAAGGAGCAGACGCAATGGAAATTGATGAAGTATGAGACAATTTTGGATGGAAGACC
AGAATACGGAAAGAGGGTCAGCGTACTGAGCGGCGTTGCTTTGAGACAAGAGAAGCAGCGTCACTGCGAATATTACAGGCAAGCAGAAGAACGTCACAGA
AGACGAGATGCAAGCGTGCCTGCATGAGGACCATGTCCAAGACCATCGGGGGCAGAGGAAAGAGTACGCGCTGCATGGCAGCATGTACCATGAAGCCAAC
TGCCCAAGCGCATCAAACGGCTGCATAAAATGAATAAGCGGTTGTTTAGGCTCGAGAGACGGCAGTAATACACGGAAAGTATACAACTGAGAGAAACGAA
CTTCTGCGACAGCACAAAGTTCAGGCAAATGTCGTAAGGAGCCGGGAAGCCACCCTGGAGAGGCAGAGAGCACTAGCCGAAAGGACAAGAAGAGCACAAG
TTAATCTTGAATCACAGTTTGATGCAGAAGAACAGGCCAAGCGTGAGGTAAAGTTGACGGACACACAGATAGAGCAGCAAATCAAGGAGGCTGAAGAAAG
AGGGTTCAGGAGAAAAACGGTTGTCAAGCGAGAAAAAGTATCCACGTCAGCCACTGACCCTCAAGTTTCTCTGATACCTGTTCTGTAACCAAAGAAAGAC
CCATCATTTAAGAGACAAGACGCCGACGATCGAATCCATCTGATGGGGTCCCCAGGAACTTTTCGCTGTCGAGAAGACCCCGCTGGATTTTCTTACCAGT
TTTCAAACCCCCCAACGTCCGCCATCACTACAGTCTCTTCATATCATGACGAATGATGACAATATGCAGCAACATACTAATGCTTCGCTTATCAGGTTTT
ACAGGCTGACTGGCAAACAAGTGCGGACACTACGTCCCTATGAAGCAGCTGAGAAATTGTCATGCTGACTCATAGGTTGCAAAAATACCGCAGTGTACAT
AGTCTGTGAGTATCCATGCACACAAGCGCCCTGCAGTCAATGATTTACACTGGAGTGGTGAAAGCACGGACTACCGTGAGGTGACAAGGTAGCAAAGCCA
TTGTTTTAGCCGCAAGTACCTAATAAAACCCTAAGGGCTTTGCCTACGCTTGTAAAACCGTTTCACAGCGTCACCCATGCCCAAGGACCAAATTCGACAG
CATGCGGTTCGTGCTTTTAGTTGCACCTGTGGAGCGAAATGCGTCGGTAATCCGTAAAAAAAATTGTCCAGCATCGAGCGTATATAGATACTGATAGATC
GATCTTTGACAGAAACATCATCTCGAACAGTAGGAACAAACACTTTGTCCCACTATCTAGCAAGTTTGATGTTATTTCGTTGTTCTTTGCAGACTAGTTT
CATTCAAGGATGAACAGAGGAAACGTTTTTGTGAAATTACCTGTGTCTTTTTGAATGCTGCATGAGCACTGTCAACTTTTGGTATGAGGAATTTTCCAAA
ATGCAGCACAAAATTGTAGGGTATACACCTGCTACTTTCAACGTAATCAGGCACATTATTGGAATATGCCCTCTCTTATCATGCCACTCTTCTTTTTTAC
ATCGGTCTTGGTTAACTCATATTCATGACTAGCGCGACCACATCTTCAACATACAGGAAACGTTCACTGGGTACCTCCCTCTACCCCAATGGAAGAATAA
ACTCTTATGTGGCAGTCACTGATATCGCTTTGTATTTGTCTACAGCAAAGTTGATAGTGAGCTTG