Description :
From Genome Similarity Track
Location :
Scaffold_1476:181- 4466
Sequence
4285 bases(100 bases per row)
CCTCGTAATCCACTCTTCTCCTGTAGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCT
GTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACG
ATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGCTCAGATCTGCCTCGTCTACCCAACTGGGCTCGTCGTATCCACGCCAATACACCAGA
AACTCACGGTAAATCCGTCCGTATCTAGTTTGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACCTCGAACTCGTCGACCTCGAGATCCACATTCCAAC
TATCCTCCGGTAGAAGGACTTCGTCGAAGTCGACGCGGTCAGATCCATCCACCGAAAGACGGGTTTGCGACCGATCTGGATATTCTTTGACCAACTTCAG
CTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTTCCAGCCGTTTTCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCA
TGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCACACTTGGATTTGATGTGGACGGGCATCTT
CGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCG
CCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCACACTGGGATGGCCGCTTCTAGGGTGGATTTGGGATTCCACCCATGTACCAAGTAAAATGGTGTATCA
CCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTG
CTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGC
TCGAAAGAAATCAACATAAAAACAGGCGGGGCCTCCCGAATCTGTTTTAAAACCATTTTGCCTAGCCCCCCAATTCTTCGAAAAAAACACTCCTCCCTAA
GAATTTCGCCAAGGGTTTGGCGCCCATTTTCGAAGCCACTACCTTTTGGCAAACCCCACATCCGTTAAAAAGGTTCCACCCCAATCCACTATTCGTGTTT
TCCTTGAACCACTGGGCAACAGGGAATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACATTCCCAGGTGACTCTCCCTTCGATCGTAGG
TCTGCCTTTGCCTGTCTCACAATCCACGCATCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCGGATCCGTTGGTAGG
TCCGACCAATACCCTGATGTCCGCCTTCCAAGCTACCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCTGGCATCACCAGTCTCATCAATCCATC
CCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAACGCTGTAGGATTTGGCATCC
TCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTCTGTGCTTTGAGGATCCGCTCGATGCGAACTC
TCTTCACGAATGTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGATCTAGTGACAGCCATCACCTGGACTGTCTTTTTCCCGGATCCAAC
CACTACCACTTCGTCAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCC
AAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGTACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTA
GGGCCGGGGCCTTGCAGTCAATCTCACCCCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAG
ATCCAAACCCAGAAGGAGTCCGTTATACTCTGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTC
CACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCG
GGATCTGGATCCGGCGTTTGGGTTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAG
GATCTCGTCTTCCCCTTTCGAACACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACTCGGCCGACTTG
AACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCT
CTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATAGCAGATCCCCTCATGTTCTTGAACCAGAACTGC
TGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCC
ACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTCCCGGG
GTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTCAT
CTGGACAGCTGGAGTGGTCATTGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAG
TTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCT
TGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGCGATTCCACTTAGTACACGCCTCCAGTAAGGA
CGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATATTAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATTCCCC
GGCTCTCCTGCTTCGAATGGATCTACTTCCGTGTGATCCTCCCCGGATCCACCCCTTTCGGGTTGCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGA
TCCGACGTTGGTAGATCTGGGGTGCGTTCTTCAATTCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGGGGATATCGCGCGAGC
TCGATCCGTCATAGTAAATACCCAAAACCCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAGTCTTCCAACAGCTCATTGATTAGAGGC
ATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGTACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGAAG
ATGCCCACGGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCAC
CCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTTCGCGGGCAGCGGGCGGTGACGCATTACCTTTACCAATCAGCAGATGTCGG
CTTTCCCAGATCTTCTGACGTAGACGATCCACTTCAGCGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTG
GTACCTCCGGGATCACCGCAATGCCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTC