Description :
From Genome Similarity Track
Location :
Scaffold_1767:181- 3693
Sequence
3512 bases(100 bases per row)
TTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTAGCAAGATTCGCACAGTGTCGGATCAGCATTAG
CTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATC
GCCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTG
CGGCGCTGTACCAGCTCAAAGATGAAGACTTTGTCGTTGAAGGTGGCCTTTCTGTGGCACGTCATTCCTTCGAAAGATTGAAGACGAGTGTTTCACATTC
ACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGAATGAGCGTTGAGCACTACGCTAATGCAAGAACATGACGGC
AAGTTACACCCCGTACGGCTCCTCGGTCGGGTGCTCAAGGAGGCCGAGATGAACTACCATCCTGCTGAGAGGGAAGTTTTGGCGTTACTTCTGCTGTTGA
AGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGC
GGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCACCTTAAGGTGCAGCGCGTGAAGGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACG
AGCTTCGTTGACCTGGAAGACTCGCTCGCGCCGCTGACGCCTCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTACTGTACGCCAGGCTTT
CCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCC
TGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCACGGTGAATGAGGCAGAGTATACAGGTATGATAAACGGTGTCAAGGCGGCTATT
GCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGC
TGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGA
AGCGCTGGAATCGAAGGTCAGTCGGGTAATCTTGGCTGAAACTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGAT
GAAGACTCGGTAGATGTTTCGTCACGAGGAGCAGAGCGTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCAAAAATTTCGTGG
TTGATTACAGCTCACCAAAGTGCGATTATGGTAATATAGCAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTC
GGAGGATGTCTCAAAAGCTCAAGAGGAGCATGAAGAACGACGAGAGACGCCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACT
GTACCATCGGCATTTCCCGATGCGGAAGATGTTGATCCGGTAGCGATACAGCGGGAACGACGCAGACTGATACTGGTGGCACAAGACGAGGAGCAGAAGT
GGTTTAACATCAAGAAGGTGCTCTAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATGCTGACCGGTTCGTATTGTCTGA
AGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCAACAACGATGATTCAA
GAGGTCTTGCAGAATTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCAACGTGTTAAGTCCGATTATTATTGGATCGGCTTGT
ACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGCATCTCGAGTAAAAGCCGTCCACAGCTTCGTGGATACTCACCTGGTAACGTGCTAGCCGA
ACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGTAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGCTCACGGGA
TTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATAA
GGCATGACCGCGACCCACGCTTCATGAGCGAGGTGTTCCAAGCGTTCGCAGAGATGATGCAGTCAAGATCACGAGCAACGTTGAGCTATCGGCCACATGC
TAATGGACAGCAGGAACGCTCGGTGAAGTCAGTGATGGGGTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAG
CTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACCTCGTTCATGGTTGGGATGCGCAGTCGACGTTGCGGGCAATGT
CGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGTGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGCCAAGGA
TTATCAGGCTGTAGAAAAAGGAGCGAAGGGCTAAAAAGCATAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTATCTCAACCAAGTGAAACGAACAC
TCGGCGGACCCCCTAGAAGCTTCAGAAGAGATGGAAGATCCTGCAAGAGCCCCACCGAGATCTCTTTTTGAGATTGGGACCCGGGCGTGGTTGTACATTG
AAGCGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCATCGGTGGCATGGATCTTTTCGGATCAAGCATAAGGTGGAAGAGTTTGCGTACGAGCTGGAAC
TGCCGGACCGAAGTGGGTATTGCTTCTACCCAGTGGTGCATGTGTCGAGCATCAAGGCTGACAACGAATTCAGCAGTCGACCGAGCGCTCGGTTGGTACT
AGACGCGACTAATGAAGCAAGACTAGATTTTGACGAGGGGTTGTTGTCTGAAGACAGCTGGGAACCAGATCAAGTTGCCGGTGAATATGAAGTCAAGGCC
ATCCTCGACGACAGAACATCACTGTCGACGAGCACGGAACGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTTGGCTACGAAGACACAACTTGGGAACCAG
CATCCAACTTGTCATGTGGAGGTCTGCTGTACGATTACTTGCGAGCCAAGAAGAGCGAGAATCGACTGCAGATGGCGCAAGTTGCGGACGAAGACTAGCG
TGACTGGATCCC