Description :
From Genome Similarity Track
Location :
Scaffold_3057:181- 2349
Sequence
2168 bases(100 bases per row)
CCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGT
GGCGTACGGGAGGCGCCGAGTACTCGAACTCGTACGAGGGCACCTCCGCCCCTGCTTTACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCC
AGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGA
CTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATAC
CGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATC
ACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCC
TCACAAGAACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCG
TGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTTCAAGTTGTCAACGAACAACTGTTCTTTCTGAGCAAGGGCTCGTTC
ATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAATCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATAC
CCTCTTGAGTTGATGGCAGCTCCCTGTCTGACGGGTGCCACCACCAAACCCCACGCACACGCTGGACAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTC
ATTCGAGACCTCCCGGGGCTCAACGATAGCACTCTCCTCCTCCTCCTCCACCTCCTCCTCCTCTTCCTCCTTCTCCTCCTTTTCATCCGAGGAGTCGAAG
ATACTCTGATAGGAGTGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGTTTGGCGCCTTCGGCTTTAGAGGCCT
TAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCACCCTTAGCCTTGACGGTCGGACT
CTCGGAGAGCACAGACGTTCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCT
CCCACAGATCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAGCTCATGTTCTACGAACCGAGGGTTCGGACGAT
TGTCTGAAGACGAGGGCGACGGACTGCGGCGCTTGCTTGCTCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCCGAGGCCACCTGAGTAGC
CTCCTTGAGTGCCGAGCCTTTGCCGTAAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCCGCAGCCTTGGAGCGTTTCTTAGCACCACTCTTTGCAGTG
CCACGAGGCATGGTAACGGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGTTGTTGCTCGAGGCTCTAACTGTGAAGTGGGCCTCCGCCGCGCTCATG
CGGCCAAGTCGATGGTTTCGACTTTGATAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAGCCTAAGTGGGGGAGGATGTA
ACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGTGTATGACACGTCATACTCCGGGATATTTTGTACAAAGT
GCCAAGGTCGTTCAAAGCCAACCATTGGTTAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATA
CTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAAATAAAGAGGGGACCTGTGAACTG