Description :
From Genome Similarity Track
Location :
Scaffold_345:18096- 20384
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_345-snap-gene-0.4Intraflagellar Transport Protein 57

Sequence
2288 bases(100 bases per row)
CACTAACTCGAGTCGTCGTCGCTCTGGTCATACTCCGGGTCCTGGTACTGCGCGTCGCCCGCTTTCCGACGGAAGGCCGCGGACGCCTGCCTCGATTTCG
CCTGCAGCAGCGTGTGGCTAGTACACAATTATTATCAACAAAATCAGATCAGACGCACGGCAGCCACCCATTTCCAAATGAACTCTACAAAAATATAAAT
TAAAATAAAATAATTAAAAGGCGTACCTGACAACGCCGATGCGCAGGTCAAAGTTCTTGATCTCGATGGCGAGCGTCTTGAGCGCGTCCTTGATCTGCAC
GAGCGGCGACGTGTCCGTCATCTTGCTGCCGCGGTCGTCCATCACGGTCTTGGTCTCGCGCAGCTGCTCGGAGATCTGTGCGTGCTCGCTCGTCATGACG
TTAACCTTGTCCGAGCCGTCCTTGCAGCGGTCCGAGATCGCCTGGAGCTTGTCCTTGAGCTGATGGAACTCCTGGCGCAGGTGCTCGTACTGGTTATTGA
TGAGCTTCTCCTTGGCGCCGAAGCGCTGGATCGTCTCCGTGAGCTGCCCGCCAATGATCTTGAGCTGGTTGTTCGCGAGCGGCAGTAGCTCCTTAATAAT
CTACAAAATAAAATATTAAAAAATATATCCGAGTCGACAGGGTTAGTTTTTTTCATCCAGGACCTCAAAAATAATTAATAAATAAATAAACAAGCCAACC
GTCTCGTGCTTCCGGGTCCGCTCGATGTGCGCGTGCCACTCCTTCCCATCATCCTCCTTGACGCGCAGCTTGAGCTTCGGCCCCACGCGCTCCAGCTCCG
TCTTCCATAGCAACGGGTCCACCTACACACACACAATCTCACCATTGTTAGCCCCCGACATGTTGCATTAACCAAATCAATCACAAATAAGCACGCACCT
CGCTGACGATCATCTGCTGGAACGACTGCTCCAGCTCGCTCTCCTCGCCATTTTTCGCGCGCGCAATGTCGCTGTAGAGCTCCTCCTCCTCGACGGGGGC
CTCTTCGTCTGCGTCCACCTCGGCGTCCTCGTCCACCTCGGCCTCATCGGCAAAGTCCTCCTTCGGGTAGCTCGGCCGCGTCCAGCCAAAGTTGCGCGCC
GCGAGCGCCTTGTCGCACACAAAGTCCAGCGCTGAGCAGGCCGCCTCACCGTAGCTTAGGCGCAGCTTGGAGGCTGGGAAGTCGAGCGGGAACCCGAGTA
CCTTGAGCGCCAGAATGAACTTGTTGATCTTGGTGTTCGGGTCGTCATACTTGTCCAGCACGAACTCGTGGTTGGCCTGCTTCATCAGGTACTGGATCAC
GTCGATGAAGCTGGTGAACTGCGCACTAAATAAATAAATCAATAAATAAATCAAAGAGATAATCACGAGCTCCATGACACATACTTTGGGTTGCTGAAGG
TCGAGACCGCGAACTGCGTCTCCGTGAAGGGCGCGAGGCCCTTCTTCTTGATGTACTCGCGCTCGTAGTTGAGCGCGCGCAGCTTCTCAAGCACGTTGCC
CATGATTGTCACGCTCACGTCCTGCCAACAACCCAAAAAGAAACAAAATTTCAATTTCCATCAAGTGAGCCGACAATTTCAAATAAATGAGACCAAGCCC
ACTTACGTCGCGCGTGGTGGCCTCCTGGCCCTTGTCGTCGGCGTTCTTGTCGTGCTCCTCTCCGTCGTCCGCCATGACTCTCGCTCTCTCTTGTGTTCCA
ACCTGAAGAGCCAACGAATGAGCTTGAAGAGCCGCTCGTTGATCAAAGGACGCACCAGTAGCTCACTTTAAAAAAAACAGCTCACACAATTTTCACAATT
TCCTTCACATTATCCACTCAAATTATTAAAAAGCAGGCTTTCAAGACCACACACACACACCTGGCTTGGGAGCTGTTACTGGGCGCGCACCGACCGTTTC
TCGCCAGACGAAGCCGCACTCTCGCCAGTCTTGGGCTTGGATCCGTTGCTGCTGCTATTGCTATTGCTGCTCGTGGCGCTCAGGCTGCTCCGGGGCGAGG
CCAAGGCCGCCGTGGGCCACGCGAACGCATGGCCGTAGCCCGGGGTCATTGGCGTCATGGCCAGCGGCGTCTCCATACCCGAGAGCGACTCCGTATCGCT
GTCGTCCTCGTCCTCGTCATCCTCATCCTCGTCTTGGCCGCCGCCCGGCTGGTCCGAGGGCGACTTCCTTAAATACTTTCGGGCGCGCCAGACGCGGCAG
TGGGACTTCCAGCGGATCTTGACGGCGTCCTCGGTGCGGCCCGGGAGCATGGCCGCGATGACGGACCAGCGGTTGCCCAGGCGCGCCT