Description :
From Genome Similarity Track
Location :
Scaffold_1072:1809- 9142
Transcript NameFunction/comments
Phyta_totarag11942hypothetical protein
Phyta_totarag11943hypothetical protein

Sequence
7333 bases(100 bases per row)
GACACGCCCCACGAAGCGGACAGGCTGAATGAGACCATTATGTTCTTGACGGAGAACAGCGCAAGCCGCTCACTGATTGGCATGTGGAATAATCACAAAT
GATTTAGTCCGATCGGGATGCCACAGCATGGGGGTTGACACAATCTTTCGTTTCAAAATGTCAAAAGCATCTTTTGCCCGAGACAAGTCTCTCCCAGCCC
GAACCTGATTATCTGTCAGCTCGTACAAGACTGCAGTAACCACAGGAAAATTTTCGATGAACTTGTGGTAATAATTGAGACTGCCCAAGAACGATTGGAC
TCCCTTCAGGGTGGTCCAGAACGGCACATCTTGAATTCCTTTGGCGATCTTCGGGGTAGCTCGAATTCCCTCAGCACCGATCTCGTAGGACAGGTACGGG
ATAGTCCGCTTTCCGAATTCGCACTTCACCGAGATGTTCCAATAACGCAACCGGTAGAGTAACGCATCCAAGTCGTCGCAAAGTTGATCCCAGGTCGTGC
TCCCGTGAGCGATGTCATCGATATAAGAACTGCGCCCCAGAGCTGGACCCATTTGGGGAGGTGCCGCGATATTCCGTTTAAACACCGTCATCTGCTCCGT
TAGCGTGGGCGAATGTCGTCCGGGGTGAGTCCGCCCCGAATCATCTTTGGTAGAGCCCAATTCAGAATCTCTCGGCTCGTAAGGATCCAACTCCAGGTAA
TCCAAGACGTCTTGGTCCACAagggtttcttcttcgggtgCCAGTCGGACAAATCCCCACAAACAGTTGTCGATCATGTGCTGGTAAAATAAGTGGTGCA
TTTTTCAGCCCAAATGACATACGCACCCCTTGGAAATGTCCGAATGGACAAACGAATGTCGAGATCCACTTGGCCCGCTCGGTAATCCGGATTGCCAAAC
TCCGCTTGCCATATCCAAGCTCATAAACCACATCGCACCTTCAAATCCAatcagcacgtcgtcaaTCAGGGGAAGGGGGTAGTTGGAAAGCTGAAGGAAG
CCGTTCACAACTCGGTAATCAATACACATCCTGATATCGACACCATTCTTCTTAAGAACGATCACGATCAGCGAGGCCCATGGTGACTCGGAGTGCTCTA
TCAATCCAGTTTCCaacaccttcttcagcaactcaTACACCTTGATCGCGAGGTGTGGAGCGATCGACCGGGGACGTTGAGCGACTGACTTAGCCTCACC
AACATCTAGGTCACAAACCACACCGCgggcaggtgctggagcagcatTTCGGTCGCCTAAGAAGATAGACCGATTGTATTTTAGGATACCCTTGAGCCGG
tgatcttcagcagcagtactCTCTTCGGGCTCACCTACCTCAGCATTGTCGAGGTCACCTTCCGGTATTAGGTCTTGCAATTCGGGTAGCAGAGCTAGTT
GGTCCTTCAATTGTGCCATCAACTCGCTTCCTTCATGGATATACACCGCGGGATCTAGGTCAAGTTCTTCAGCGTTCACTTGCATACAACGGGCATATTC
CAGCTCAAGCAACCTGACTGGCGTGCTCGGCATTGCTGTGATCGCCATATCAGCTTCTAGATCGTTCATCTCCGGTGTACTCGAGACTAACTTTTCCTTG
CGTTTCAGATCGGAGTCAGCGCTGTCCTTGTTTCCATCATCTCCTGCGTCTAGTTCACGGGGTGAACCCGCTTTAAGCGCGTTCGGACAGGCACCACTCC
CTTCAGCCTCACGCCTGGTCTCAATGTTTTCTTCAACCGAAGATTCCTGAATGTGGTCTCTGGCCGTCTTTGCTCGCGACGTACTCTGATCCGGCACTAA
ACATTCCCGAATGACCTCCTCCGGTTGCTCCGAGATGGTGACCAGTAATGGTCGAGCCTTCTTTTGTAGCTGCACCATGCTGACTTCTCCTGTCTTCAAC
CGAGGTCTCAGTAACAGCTTCGTCGGCCACTGGTACTTGTGAGTCTGGACAGCAGGTGGTTCCGCATCTCGGAGCATCTGCGTGAAGCGTTCCGCCCGCA
CCCTAGCCTGAGCCGAAACGGTATTCTCGTAAACGAGCTGTTGCCAATCCTGGTAGCGCCTCAGTCTGGGACGCACAAAACGTCCTGCACTTGGGAGAAT
CCGTACCCCATGATCCGTGTTCGAAAATCAATCCATAAGTCTCTGTTTTAGATATTCGCAACTCTCACCGCCGTACAAGATCTGAGTCACCCAACGGTCA
CCTCGGCCCGCCCAGACTACATCACTTTTAGGATCACTTCGGCCATACTGAATCCGAACACTTGCATGTTCTCCGGGCGTAGATGTAGATCGTGAGGGGC
GGAGTTCGGGATATCCAAACCTTGGTGCCTCCGAATGACTTCTCCATACATGAGTACCGACTCCTCATCCGGAAGTAACACAAGCTCTTCCCGGATGCAT
AATCGCACACTAGCACTGAACATGAAATCTATGCCTAGTAGGACGTCGACACCTTCACCAATGTTCGTCACCCATAAATTGAAGGCGTATACGACGCGAT
GACCTAGAGTCACCTTGACTTGAGCACTCGCAGTGATATATGTGGGGACGCCTCCTAGACCGGACACCTTGATCTGCTTGTGTGAGCTTAACTTCAGTTT
GAGCGTACGCACAAGGTCCAAGCTGATCATGCTCACAGTTGCTCCAGTGTCCAAGAGGATCTGCATCATGACATTATTCACCGCACCATGaaccacagca
acacgacaCTTTCCTTCATCTGGATCGTGTTCGCCCCACCAACCATACCGTTCTCCCGGGCTCAGCCTGAATTCGGCTGGGCCTTCGGGTTCCGCAGGCA
ATGATGGTCGTGGAAACTACAAGTCACCACCCTCGGGTGTCCCAAGGTTTTCATAAATCAGAGAAGGCATGCATTGTTGGTTATCTCGGGTCTTGGTCCT
CAATTCCGGGCCGACATACACTAAGACACACAATTCTGAGGGTTTTCTCTGCCCGACGCGTATCAAATCCTCATTCGGCGGGATTAGTGGTTTAGCTGTG
CTCCCTTAGAATTGGCCTCACCATCCAGGATGGCCTCACGGATGTGGCTAGGCAGGTCAGTTAGGCCTCCTTGGCGAACCAGTTTCTTGATCTCTTGGAA
GGCTTTCCAGTCCTCGCGTCGTCCTTCATGATACAGCTCACACTTCTTGCAAGGCTTCACTTCATATCGTTAGATCGGGTGTTcgcggcggtggcagtgG
CCACAGATCAATTTTTGCCAAACAATTATCGGGTCGATGTCCCCACTTTCCACAGTCTTCGCAGAACTCGTTCCGATTCGGGTTGTTCCGAGGCGGATAA
GGCGGGTAATGTGGCAGTGGGGGCTGCCTGAGCGCCTGCGGTCCTCCATCGGGGCCGGGCGTCTGGCCTGCCAGCCCACATTCTCCATCACTCGGTACAC
TTCGTGCATAAGTTCTTCCTTGGTCACCATGAGGGCATCTTGGGATACATTCGACGTGCTCCCCTCTTGGTCACCCTTATCCAACGCGTGCAGATATCAG
CCATCTCGGATCTGAAGGAGTTCACTGGGAaagatcaagatgaagatcggGCAAGAGGGTGGATCAGCAAGGTTAAGTCCGCATTCTTGCGTGATCAGGc
cttcgacgaagaaaagTGTTTGACATTCGGAGATCTGCTGACAGGACCTGCGCTGAACTGGTATCGTCAGTTGAGCTGAAAAACGCGAAATATGTTGAGC
GATCTACTCCGCAGCTTCCAGACTCAATACTGCAGTATCGGCGTCTCAGTCGCGAGGTAATACTACCATACACGCAAGAGATCGAACGAGACCCCGCTAG
GATACCTTTACCGACTGAACGTAGCGGGCTTGCGAGCAAGGTTGAAGGTCAAGGATGGTGGAGCGAAGGAACGCCGAGAACATGTCGACCACTTCATCGA
GACACTTGGAGATCAAGACCTAGCCGATCAATTGACGTTGCTGCGACTGGCAGATGCTGACGAGCTAGAGGAGATCCTACGGGCCCGTGAAAGGGCCAAA
AGTCGACTGAAGAAATCAGCCTTTGGATCCAACAAATACCGACAGAAGGTAGCCGCGCCGACTCCAGCCGCACCAACAAAGCGGGCGGTCCAAGTGATCC
AAACCCAAGACTCCGATTCTGGATCTGACTCTGGATCTGACAGATCTGAGTCTGAGGGAGACTTGTGACGGATCTTCCTGACGTCAGGGGATAACCCACC
GCTGGAGCTGACAGATCCAACCCGAAGTGGTACAGATCTAGCTCCACAAGACCGAAGATCATCAGACCGATCACCACGAGAACCCAGATCGCAGATCCAG
CAGGACGGGTCAAACCGCAACCGTCGTTCGCATTGTGGATCTCGTAAACACACGGATCtcggctgctggagacgttTGATCTGCCAAAAGTGCGGGAAGA
AATGTCACCCGTCGGATCACTGCATCTTCGTGTGTCGCGGATGTGGAGAACTGCAGGATATGGGAAAGTGCCCGATGGAGGAGTTCTACAATCAACTCCG
TCAGTGGTACGATCCGACCAAACATGCTGGCATGCTTCCGGCCATGTCTGAGAAGACGTTAAATTAGGTCGCTCGTCAGGTTGGAATCTGATACGAGCCG
AGCGTTCTGAGGTTTGCATTTATGCAtttgtggagaagaagtcggtAGATCAAGTCAGCGGGCAGCAGCTAGGTCTACGCGATAATACATGTGATCTACA
TGAGAAACGCACAGCCATGGTTGCAAGTCTTCATCATGTAGATGAATATAGCAGATCCGATGATGTTTATGGATCTCCTCGCGGGAGAGTCGCGAGGTTA
CTGGAAGCATCACGCGCCTGGTAAGTGGTTCAGACAAGCAAAAATAACGGGGAAGATCAACAATGAAAAGGCGATCTTACTCTTAGACACCGGTGCTGAG
GTGTCCATATTGGACACCGCCTTTGCTCATAAGGTTGGGTGCTATGTCGACACGAGTCAGAGCCAGGATTGTGTGGGGATTGGAGAAAGTACATTTACGC
CGAGTGGAAAGACCCGAATCAAGATCACACTAGCGGGATCACTAGTGTATTTCTTCGATATCTGGGTGGGTGATCTGGCAGGCCAAGATGCTATCCTAGG
CATGGATTTCATGGTACCGGCTGGATCTAGCCGATGGGTCGATCTGCTTGCCGGACGAAGTGAAGATCCAGCTTaatggacgacgacagctccacaATGA
CAAAGCGGGGTTCTTGAGGCTAGATCAACATACGCAGATCGGCATCGGAGAATCCGTGGAGCTACCAAGGAGCCTCAGATCTTCCAATCAAGAAAAATGA
TGGAGCACTAGGGGAGATCGGTGGGTACCCACGGTGGTCAGCGGCCCCGGCAAGTCAAGATATCTGCAGATCACTAACATCAGCGACAGGAAACTGATCC
TCCAAGGTGACGAGCGAATCGGGATGTGGCTGGCAGGAGATCGAGTGCCACGCGTCCCAGGATTCGTCTGTGTTGGATCCCGCCGCTATAGGGAATGGCA
AAATCTGACCCTGGAAGCTACCACAGAGACGAGATCGGAGGAAGGCCAAATGGTCGACATCGTTGACGGCCCTAGTGTACATCGACCGGAGTACCCGACA
CCTCGCGCGATATTACGGAGAAGTGACACGACGCCGACCCAACGTACATCGATCGGGTTGTTGAGAACCGAGCCCAGATCGGGCACTACGTTAGGCGACC
AGGTTTTGTCTGgagaggcgacgacgacgtttCCCGGAAGCATCCCGGCGCGAGTGGACGAGCTTTCGGGGTAGACGGATAAGGCGATAACAGGGGCGTC
AAAGCCAGATCTAGAAGATAATAAGCCATCGGGATCAGATCTGGTACCTGCATACGGGGATACATCGAGCGAAGTGGATCATCGATCGCCTACCATAAGG
ATTGCGAAGTTGCTCCTGACAGACGTGTCAGCAACAGGCCCAGACCGCAGGCTGAAGCCGATAAACCACTCGAAACAAGTTGATATAGATCGACGAAAAG
CGGAAGATCAGGTTGAAGAGGAGTAATCTGATACCACGAAAGCGGAGGTCTGCACGCCGAGGAAGTTCAAGGAGAGATGGCAGTACTCCCAGAAGTCACC
CTGAATACGGGTGAAGTTGCGATCGACGATATCCAAGTAGAAGATCCGGCGTTCAACTCTCTGGAAGAGATCGATTGCCTACGTCGGAAGATCTGGAAGT
ATCGACATCTGCTCGTCGGCAAGGGTAATGCCTTACCGCCCGCTGCCAGAGGTGTTGTATGCGACATTGTTGTGGGAAACGTTAAGCCGATCGCCCACCG
CGTGAGAAAGGTGGCCCCACAGTTCCGGGAAAAGTTGTCAGAGGTGATCAAGGGACTGCTCGCTGCCAGCATTATTCGCCACTCGACGTCTCCCTGGGGT
TCCCCCATAGTGGTGATCATCAAGAAAAATGAAGTGTATATACGGCTGCGCATCGATTATCGACTGGTGAATAGCCTTACAAGACTTATGGTGTATCCGA
TGCCCCTGACCAACGACCTCTCAGAAGGCCTCGACAAGATCTTGTGGTACTGTTCGCTTGATATGGCGAGTGGGTTCTGGGTAGTTACGATGACGGACCG
CGCCAAAGCAATTTCGGCCTTCACCACGCCGCTTGGCTTATTCAAATGGAATCGGATGCCTTTCGGCCTCAAGAACGCTCCTCAGATCTACCAGCGCCTA
CTGGACAATGCGCTGTACGGGTTCACTCGGATCTTGCGATCCGGTGACTGCCAAGGGATCACAGATCTgttcgaagacgaagcgcCGGACGATCCGAGTC
AGCCGTCGGTTTTGGGGCACCGATCCTACATCGATGACATCCTAGTAACTGTCAGATCGTGGGATCAGATGTGCGATCGAGTAGACGCCCTGCTGACGGC
TTCTGATAAGTGGAATTTGTCGATCAGCGTGGTCAAGAGTTTCTGGGGAAGGCACAAGGTAGATTATCTGGGACATCAGGTGTCGAGTGATGGGCTCGAA
GCCAACCCCAAGGACTTGGAGGCGTTGATCGGTCTACCCTTCCCGGGAACACTCCGAGCCATGCAGTCTTTTCTGGGCAGTTTGAATTACTCCAGCCGCT
TCGTCGAGGACTTCGCAATTTATGCAGCGGTGCTGTATGAATTACGGGGGGTGGACTTTGCCgcgctgacgaagaaggggACGCGTGAACAGATCGAGAG
CCTGCTACAACGCCCTGATCCGGATCTGGACCAACCAGACCCAAAGACTACATATCTGGAGGCGAATGGGTTCTGCCCTCGAGATCGAGAGGTGTCGGTG
GTAGACGAAATCGATCCACGATGGATCCACGCT