Description :
From Genome Similarity Track
Location :
Scaffold_958:1809- 2918
Transcript NameFunction/comments
Phypl_g11814hypothetical protein

Sequence
1109 bases(100 bases per row)
tccgcACTACCGGGCACGGGAACGTATATTGACCCACCCGACGCTACGCGGAGCTGTACCAGACTGCAAGAGGACATCGGACGCCTGGATTGCTTGGCCA
GACGCCCGTCAGCTCTCACTCAAGACCCCTCGCTATAGGAAGCGACAAGCCCGGAAAGAAGGAAGGCGACACGCCGACCGCAACGTATTGGCCGGCCAAG
ATCAACATTGGCTGGAGAGTCGCGATCTCAACACTCGAGATCGGTGTACTCAACCCCTATCGGCGCAGCGAGTAGAAGTAtccccgctgctgcccccaAG
TTCCCGCTGTCCACCAGACAGTCCAAGACCTCAACAANACAAGGTGAGAagatcagcaacttcacggaAGATCGGAGTACCTCCTCCGTTAGTCGGCAGT
TCGGGCGCCGTATGCAAGAGGAACCCCGCGATCAGCAATTTTCGCGGATCCACTTCGCCACaatggtgcgcgtgctcggGTCTTTGGATGACTCGGGATT
TCACCGTTAGTCCCCCCAAGAGGATGCGCAAGCTGAGATTGGACCAGGGAACCAAGCGTCGACGGATGAAGGATCaccgacgacgccgctgaaTCAAGAT
CGATCCGCGGATCGGCAGAGTTTTGGGAGGAGCTCTACCGACAGAACAGAGGAAGGCCCGGCGACGGACCTAGAAGAAAAGCCTCGACCTCATCCCCAGG
TCCTATCGGGGACTCCTGCGAGTCTCGATTCGCATCGAGATTCGCTGGACGAAAGTCCACCGGCGAAAGCCAACCAACCGCCCTGCATCACGAGATcgac
ggccaagaagaaacccGCTAGATCGAAGTCGGCGCGAAAAAAGATGAAAGCCCCAGACTCAGACACTGAAGGTCGCAGTGATCTGGTTCTTGCATGGAcg
gatgaagcgcttgaggtAGTGTACCACAAGAAGGAGCTACATGCCTTCCTGCTTCAAAACCCGGTGATGCAGATTCTCCAACCAAACATTATCGGTGATC
TCAAGGGACTGGTCTCCGAGCCGGTAACGAGATCGAGTCATCTCGACCTGGTGAAGacacttcttcatctgctcAAGGGGTCCGGAATCGTCGCTGGAGC
ATTTGAAGC