Description :
From Genome Similarity Track
Location :
Scaffold_416:18089- 20865
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_416-fgenesh-gene-0.4Anaerobic ribonucleoside triphosphate reductase
Pytve_DAOMBR484maker-pve_contig_416-fgenesh-gene-0.5Sphingolipid delta(4)-desaturase DES1

Sequence
2776 bases(100 bases per row)
CGAGGTCGAGCGAGATGTTGGTGAATGGCGCTTGGAAGCCACTGCGCGTCGGCACGTTCATGGAGAAGACGAACGACTGCACGGCCTTGAACACGTCCTC
ATAGCTGAGTCCGTCCGCGCGGATGAAGGGTGCGAGGTACGTGTCGACGTTCGAGAGCGCCTGCGCGCCGGCCATCTCGCCCTGCAGCGTGAAGAGGAAG
TCGACGAGCTGGTTGAGCGCCGTGGCGAAGTGCTTGGCCGGCAGACACTGGATCTTGTTGGCCACGCCGCCGAACCCGCGAAGGAGCACGTCCTCCGTGC
TCCAGCCGGAGCAGTAGGCGCTCAGATATCCCAGGTCGTGGATGTGGAAGCGGTTCTCGTCCGCCATGGTCCTCACCTCGGACGAGTAGACGCTGTGCAG
CCAGTACTCGGCCACAGCCGTCGTGGCGATGTGCTGGCTCAACCCCTGCAGCGAGAACGTCACGTTCGAGTTCTCGGCCGCCTTCCATGTCGTCTTGTCG
AGGTACTCGTCCACGACGGGGGCGATGGCAGTCGCGAGCATGGCGCACAAGATATTGGAGAGCTCGGACGAGGGCGGGAGGCGGAAGATCGCAAAGTGAG
GAGCAACCAACCGCCCGAGTTCAAATAAATTGGCGCCAACCGCCGCGCCATTCGAGGCTGCTTGGCGCCAACGAGCTGGTGAATCCGCCAAGGTCGGGTG
GAAGCGGAGTGATCAACTGCTCGAATGCTATCGGATCAAGTCAAGGCGGCCAATCACGCCGGAGCCAGGAACATGCCTCGCCGGCCAGCCGCAGGCGGCG
GCCAAGACATGCAGGGATGCCACATAAGCGCGAGACGTTTGCTCGGTGGCGAGCCGTGGAGGGGTTCGCCAGATACGCACTGCGAGCTCGCATCGATGCA
ACCGGCGAGACTTCCAGCCCATAATATGCACGTCTTTCACATACAAATGAGGTCAATTATGTATTATTAAAGTGATTTTGGCAGGTTAAAGTCAAAATAT
TATTCAATATATGATTATTATTATAAAGTAAGGGTAATGTATCCTGGATGAGCTCATTCTAACATGTCACGCGGTTTCCCGCGCACCTCGGTGGCGACGG
CATTGGCGCTCGCGCCAAAATTCAAAGCTGGACGACAGCGAGCGCGCCAACTTGGCGACCGTGGACGACATCGTAGCTGGCGGTAAACGCGTTTCTCTCC
ACATCACTCCACACCACCTTAGTAGTGTAGATCAAATCCACACAACTCACTCGAGACCGCTGATTGACCACAGTCTCGACTGCTATGTTAACAATACACC
AAAGATCATAGAGCAACGCAGTTCGGCGTCTCGATGAGGCGTGAACCGACTCGCGGTGCCCTGGTTTCGCTATTCTCAGCTGCCTCGGCTCGAATCGCAG
CTTATGATCGTCTATCATGGTGACATGACCGACTGAGTCTGACCATCACACGGCTCGCTACTGCACCATACCAAGCGATTGCACTAGAGCCATGATCCTG
AGTTCGAGTTGACCTTCATCGACCTGCTTCGCCGCGCTTGTGGACTTGGATCCCCATTGTCAGGAAAAGTGTAGCCATGTCATGCCGAATCATGTCTCAG
ATCTGCCACGTCAGTGCAACTCGTTCCAGCTCAGCAGCGCCAACGACACCGTGTATGTGTGTGTGCATTACTACATGTACTTGCGCTGTGGATTACATAT
GGTCGTACGCTCTCTTCGTTGCCTCCCGCGCAGGTGGCACTCGCCTCTCCACGGCCCTCACCGCGCGTCCCAAAACTGCAACGCTAGCCCTCCAAACGAC
GAGCAGGTGGCTGCGACTGAATGCCGCCGCTCTACGAGCTCTTCAGCTTCTTGAGGTCGTCGTCCTCGAGCGTGCGGCGCTTGACACGCGAGTACGCGTT
GATGTTGGGGTCCATCACGTAGTCGTACAGCACCTTGACCCACGACTTGTGGCTCGGAAGGTTGTCGTAGAACTCCGGAGCGAGGTCATGCAGCTGGTGG
AGGCGCGAGCCCGGGATGAACGGGAAGTCGTGGTGCTCGTTGTGGAGACCGACGTTGAAGGTCACCCAGTTCAGCACACCGTAGTACGAGTACGTCTCGT
AGCCAAGGATGAACTCGTAGTGCTCGGCGATGAAGTGGCCGGCCACCGGGTGCACACCAGCGCCAAGGAAGGTGCCCACAAGCAGGTACGCGAGTCCCGC
ACGGCCGCCGTAGTAGTAGATGGCAAAGTCGTAGGCGGCGCAGATGATCCAGTTGTAGAGCTCCCAGAGACCAGGCTTCTTCGGGTTCACCACCAGCGGG
CGGAACGCGTAGAAGAACACCTGGAACACGAGGAAGAGCAGCTTCGTGAACTTGTTCGAGAAGATGCGGCCCTCCCACTCGGTCGGCAGGTCCGCGTCAA
TGCCCTCCTCGCCCTGGTACTTGTGGTGCTCCGCGTGGTAACGCTTGAAGCTGATGGCGGACGGCACGCCGATCGGCAGGTTCGCCATGATCGCCAGCAG
CTTGTTGTGCGTCGGCTTCTTGAACCCGAGGTTGTGCGAGATCTCGTGCATCCCCATCATCATGGCGTGGTTGGCCGTGCCGCCCACCACGTACATGACG
GCCAGGTACACGGGCCAGCTCCAGTGCTGCGCCTGGATAGCCAGCACCGACTGGAACGCCACGACCGCCGCCACAATGTACTTGGTCTTCCAGCAGTGGC
CCATCAGCTTGGTCACCTCCGGGTGCTTGGCCAGGATGAGCTTGCGCCGAGTCGCGTGCGGCTCATCCGTCGGCAC