Description :
From Genome Similarity Track
Location :
scaffold_11:18087- 22487
Transcript NameFunction/comments
Pl_112488hypothetical protein PHYSODRAFT_484074
Pl_112489conserved hypothetical protein
Pl_112490hypothetical protein PHYSODRAFT_312309

Sequence
4400 bases(100 bases per row)
CATTCGAAACCTCATTTGGACGCTCGAGAAGACAAGCCCAGCTCGAGCCATGTCAAGGTGGGAATGGAGAGGGCAACCTGTCATACTCGACTCATGGGCT
TGGGTTCATGGCATTCACCTGATCTTCTGCGTGCAAACCATATTTTCCCTGAGTGTGTTAACACTCATTGTTTATCGGAATGTACGCGACGGTAAAGTAT
GGGTGGGTGATGCCTTCGCTTCCTTGTCTAACAGCACGCTCATGATTCGTGGTTTGCTCGTATTCGCCTCCTGGTACGTAAATGGAGAGTGGACACTTCT
CGAGTTCTGCATCTCGAACGCCAATGATCTCACAGGTACTCAGCTCGTACCAATCCATTCGGAAATCGTACACGCAGACCTTATGGTTATGTTCCTGAGT
CTGTTTGGACTGGTTGGTCACATTGCAAAAGAACGTATTGATCCGACGATCGGTGTTTTTCTCTATGAAGCTATCCACGACAATCGCCAACCTATTGTGA
AGATGAATCCTCTTGTGTTCAAGACTGTTCGAGCCTTCTCGGATAAAGAATATCGCCTTGGGATTGCTACAGTCACAGACCTTCAAAGCCAAATGTCTCC
AATGCGTCTTTGGACTACTGACAAGCTTACCCGTGTTGATAACACATTTGTCATAGCCTCCTTCTACCCGAAGTACATCCTAATGGGGACACTAATTTCT
TTCGTGGTGGTGCGCAAGATCTACAAGAAAGTTTATCCGGACCCGTTAGCTCCCAGCATTACAGGCAGAAGCACAGACCGATCCACAAACGAACGAGCTG
CCATCGCACAGAAAGGAAACCTCACCAACTTCGAAGTTTCTACCGGTGCCGAACTACAGGCTCGCTACGGCCTGATCTCCGATTACAAGAACTACGTGTT
TTTCAAGGGTCTTAAGTTTGCCTCACCGGATGGTGTGTACTGCTCCGGGTACGTGGTCGTCAACGGAAAATATCTCGTTGCTACAGAAGATATCTTGACG
ATCGCAATGGTCAAGGCCGTACAGACGCGCTTTATCAATGTTTATGCCTACGAAGTTGACGGCTACACGGTACAACGGACAGCTAGACTCGTGTATCCTA
AAACATTCACGTGGAATGACCTCTTGCACCTGAATATTAACATCCTAGCATAGATACAGAACAAACAGCGACTAAGGCATAAAGCAGATCATTCGAATTT
AATTGCTCCCGTACGTATATCAATGTGATCCATATCTCGAAACTAGATGAAGCGACATTGTCGACGAAGTCATCTCCACTTCTTCATGGCAATGGCCTCA
CACTCACCTTTGCCAAGTCATGCCAGGAAATTGTTGTTGGATACACCAGACGAGCTGTTTGATTGACACCCGTGTCTTCTTTGATGGTGTACACGTAAAT
GTTTGTAAAACGTGCCCGCGTGATTTTCATGATGAGCAACGACATCAAGTCTTCCGTGGCTATAACAAATTTGTCGTTCGCAACCACGAAGCCGTTGCAG
TAGATTGCATCCCCTGATGCGAACCTGCGGCCGTTCATGTACGTGTAATTCTTGTATGTCGACAAGATTCCAAATCGATTCTTCAGTACCGAACCAGTGG
CAGTCTCAAACTGCATCAACTCCCGCGGCTGTGAATCACTACTGACCAATCCTGACTTCGAACTTTGACGTCTGGATACGCTTTTACTATCGCCCTCTTG
ACTGCCAACTTGAAATCCCGATGAATGACATCGCATAAGTTTGCGTATGATGATGTATAACACGATGACCACAATGGTGCTGTAAATGACCACAAAGGTG
ACTATAAGCAGTGACCACACGTTCTGATGGATTGGGTGCACTGTCCAAAGACGCATCGGAGACAACTTGGACAAGAAATCGTCCACCTCCACTAAACCAA
AGGTGTTCTCAGTATCAGAGTAGTCGACGAGAACTTTTTGCAGCGATGGGAAGATCGTTGCCATGGCTTCTCGGCTATTGAAGCCCACCTCGAAGCAAAC
AAGTACAAAAATTGGGTCGATTCGCTCACGTAACAAGTAGCTGAGTACACTCACGATGTTCAGGTAAATAGTGAGCATATCAGCATGAGCCATTTCTGGG
CGATACTTGACGGTTGCATCACCCCCTACTGAATTTGCAAGTGCAAGGCAGAATTCTGTGAGAGTCCAGTATCCATTCACGTGGTTAGAAATGATCACGT
AGATGCCACGATAAAGCAACGCATTTGAGATGGACGCAAATGCGTCTCCAATCCAGAAATGCTTCTGCAAGATGCTGCGGTACACCAGGAACATGAGCAA
ACTCAGCTGAAACATCACATCAATTGCAAATAGCAAATGAATAATGTGAACCCAGGCCCAATTGTCTCGGTTGATAGCATCTCCATGCCAGTACCAGTAG
GTCAGCGCACTTGCAGGGTCGTCTGCGGGTTTCCAGTGGAGGTTGATCTGGTTTACCTGGGAAGTCTCCTTATCGAGGTAAAATCCTAGCTGTCGGGCTG
TTAACAACGGTTTCGGGGGTCTCATGAACGGGTCTCGAGGAATTGTCTCTAATGACCAGAACCCTTCATCGGTGAAGTTGTTAAAAATGCAAACTTCAAA
GTCCGGCTTGTACTCGTACGGATAGTCGAGTGCGATGGCGAAATGGTGGGGAACTGGATCAGCAGAAGCCATATCTTCGACAACAGAAAATGTCAACAGT
AGAGCTGCTCCACGCTCGTACTGCTCCGCAATATAGTAGTCTTGAATTGATAGTGATGTAGGAAGTAACAGTACGCGTTCTGAGTCGTTCTTGTAGCGGA
CAAGGTAGTTCACTCGCGCTACAGCACCTCCTCCACCATTGATCACATCCACCTTGCAGTCCACGACTGGGATTACCAACTCAATTTCGTCTAAAAGCGA
GATATTATACGCCGTCTTGTTCTGCAGGTCCTCGAAGATCCAACGAAGAAAATCATCCTTGTAAATAGCACTGGCATCGCCCTCAGTCACAGCAGTACAC
TGTGTAAATGATGAACTTGACTCGGACTCCAGAAAAAGTGTCCCGGAAGCATTCGGTTGGGTAGAACCCCCCAGAACATCCACGACCAGCGGGCTCTTTT
GGATCGTGCTCGAACCAGCATATCCAGCAATGAGTGGCGAAGACATTGGGATTGGACCAGTTCCATAGCGTGCTTGGTTCTTTAAGATGTGAAGTGAGGC
ATCCGTCGCCATCAAGGAGATGACAATGTACCAGACTGCAGCACCAAACACGAGTAGTCGATGAACGAGACGGAATTTTCGCTGGAGTGGAGTACTTCCT
TTGACCTGATCCTTCTCGGCTACTGTAGGTCCATCTTTCGCTACCATTACTTTCCCATCAGGGCCCATGCTCACTTCTCGATTGAAGCAGCGAGAGAAAT
AGGAAATTAAACTCCAAAGAAAGAGGCGTCCGTTTCACTACATGGCAGAGGACAACAAAGCATGAATAGATTTCATGGACTGCAGCGCGACTGCCTACAG
AGGTTTGACCAAGAAGTGTCAAGAACTTGGAGAACGCGTTGAAAAGCTACTGCACGACTCAGTTCCAGCGTTTTGCGCAAGTAAACTCCATGCGGACTGT
CATCAAGAACTGACGTGGAGTCGTTCATTTAAGATTTACAGCGTACGCCATTGCCGACACAATGACTGCGAGCTGTGACGAAAATGCGTCCAACACCCTG
CTCCAGTCTCGATCTCGTTTCCCGGACCAACATCGATATCCGATGGAGTAAATTAGAGCCATAAATCAGATCCTGTATAAGCCCTATCAATTCCATCCAA
TCATATGGGGAATGACGGATAGGTCGTAAAAGGGTTTGTACAAGCTCCATGAATTCACTGCCTTCGACTATACCGCGAGAGATCTACCGTTTTCATCACT
ACATAAGCACATTTCCAACCTGATTTCTTTATCTGAATTTTCGAACTCATCATATCTGGTCAGCGGCGATGGACGAGAGCAAGCGACAGCCGGAGGAGCA
CGAGGTGCTTGCCGAGATCCACGCAGTCATTTCCAACAACCCCGAGTTTGGCTCCAAGCGCGTTGCCAGCAGCATCAAGAGCAGCAATCCGGACTGGCAC
ATCGGCGACAAGAGAGGTGCGTTCCGCTGCAAGTGCTCACTTTCATGAGATAGAAACGTAGAGCGGGGCAGACGAAGCGGGACATTGCCGCACTTGGACA
TTGTATGGTTCCATACAGTTTCCAAGTATCTGCGGTATATGATACTCTCAGCTGGTCCACCTACGCCCTTAGGATATGTGCATCCATTTCTGGTTCCACC
GGCGCTCGCTCACTCTGTTGGGACTGTGAATGTTCGCAGTGAATAAGCTCCTGAAGAAGTACAAGTCGTCCAATAGCATGAGTTCCGACACCAGCAGCCC