Description :
From Genome Similarity Track
Location :
Scaffold_171:18085- 21993
Transcript NameFunction/comments
g9913.t1hypothetical protein

Sequence
3908 bases(100 bases per row)
GAGCTGCCGACCCTCCCGAACGAGCTCAAGAAGACGCTGATGGGGCCTAAGAAGCTCACGGTCCGCAAGGAGATTCTCAAGAACGTCAGTGGTCGCTTCG
TGCCGGGAAAGATCACGCTGCTGCTGGGTCAGCCCGGATCGGGCAAGTCGGCGCTCATGAAGATCCTCAGCGGTCGGTTCCCCATGACGAAGAACATCAC
GATGGAAGGTGACGTCTCTTTCAACAGTGTGGCGAGGGACCAGATCGCCGACCGGTTGCCGCAGTTCACCTCGTACGTGAACCAGCGTGACAAGCACTTC
CCGACGCTGACTGTGAAGGAGACGCTCGAGTTCGCACACGCTTTCTGTGGCGGGAAGCTGTTGGAACAGGGTAAAGGTATGCTGGAAATGAGCTCAAAGC
AACACAGTGACATGGAAGCTCTGGAAGCTACGAAAACCATCTTCGCTCACTATCCGGACGTGGTGATTCAGCAGTTGGGACTTCAAATCTGCCAGGACAC
AGTCGTCGGTGACAACATGCTTCGTGGTGTATCGGGTGGTGAACGCAAGCGCGTGACGACTGGTGAGATGGAGTTCGGCATGAAGTACGTGTCCTTCATG
GACGAGATCAGTACGGGTCTCGACAGTGCGGCCACGTACGACATTATCAACACCCAACGCAGTTTCGCCCACCGTCTCCGCAAGACGGTGGTGATTGCGC
TGCTGCAGCCGTCGCCGGAGGTTTTCTCTCTATTCGACGACGTGATGATCCTGAACGAGGGCGAACTCATGTACCATGGGCCATGCAGCCAGGTGGAGGA
CTACTTTGATACCCTTGGCTTCAAGTGCCCTCCCAGCCGTGACATCGCGGACTACCTGCTGGATTTGGGCACGAAGCAGCAGTATCGCTACCAGATCTCC
CACCCGACCAAGCAGCCTCGAAGCCCGAGTGAATTTGCAGAGTGCTTCAGCCAGTCTCGGATCTACCATTCCACTCTGGCTGCCCTGGATGCTCCGTACG
ACCAGAAGCTGGTGGACAGTGTCAAAGACATCATCGACCCGATGCCTACGTTCCACCAATCTATGTTTGCTAGTGTGATGGCTCTTCAATGGCGAGCTCT
GTTGATCACCTACCGCAACAAGGCCTTCGTCATGGGAAGGTTGATGATGGTGATCATCATGGGTTTGATCTACTGCTCCATCTTCTACCAGTTCGACCCG
ACGCAGATCTCGGTGGTGATGGGAGTCATGTTTGCTACGGTCATGTTCCTCTCCCTGGGTCAAGGTTCCATGATCCCTGTCTACATTGCCGGGCGAGACA
TCTTCTACAAGCATCGCCGCGCCAACTTCTTCCGGACGGGGTCTTACGTGCTGGCCACGACCGTGAGTCAGATTCCGTTGGCCTTAGCTGAGACCATCAT
CTTCGGCTCGATCGTGTATTGGGTCTGCGGGTTTGCCTCCGACGTGAAACTGTTCATCATCTTCGAAGTCGTGCTCTTCGTGTCCAACTTGGCTATGGGG
ATGTGGTTCTTCTTCCTCGCCGGCGTTTGTCCCGACGCAAACGTCGTGATGCCCGTGGGTATGGTCTCGATTCTCGTGTTCATTATTTTCGCGGGTTTCA
TCGTGACCAAGAGCCAAATCCCGGACTACTTGATCTGGGCGTACTGGATCAGTCCCATTGGGTGGGCATTGAAGGCTTTGGCTATCAACCAGTACCGGTC
GAGCGAGTTTGACGTGTGCGTGTACGATGGAGTCGACTATTGTGCGAAGTACAACGGCCTCATGATGGGCGAGTACTACCTGGACCTTTTCGATTTTGCC
ACTGAGAAGAAGTGGGTCGTGTACGCCATCATCTACCTGTTGGCCGTCTACGTGTTCTTCATGTTCCTCTCCTATCTGGCGATGGAGTACGTTCGCTACG
AAACGCCAGACAATGTAGACGTGTCCGTGAAGTCCATCGAAGACGAGAGCTCTTACGTTCTAGCCGAGACGCCCAAGGCTGGAAAAATGGAGGGCAATGT
GATTGTAAACCTACCAGTTGAGTCTCGTGAGAAGAACTTCGTTCCCGTGACGGTGGCATTCCAGGACCTGCACTACTGGGTGCCGGATCCGCACAACCCG
AAGGATCAACTCGAGTTGCTCAAGGGCATCAACGGGTTTGCTGTTCCTGGTTCGATCACGGCTCTCATGGGCTCAACTGGTGCAGGCAAGACGACGTTGA
TGGATGTGATTGCTGGCCGTAAGACTGGTGGCAAGATTTCTGGTAGGATCATGCTGAATGGCTACGAGGCTACAGACCTGGCCATTCGTCGAAGCACGGG
ATACTGTGAGCAGATGGACGTGCACTCGGAGGCGGCTACTATCCGCGAGGCTTTGACCTTCAGCTCGTTCCTGCGCCAGGACGCATCGATCCCGGACTCG
AAGAAGTACGACTCGGTGAACGAGTGCATTGAGCTGCTTGGCTTGGAGGACATCGCGGATCAGATCATTCGTGGCAGCTCCGTGGAGCAGATGAAGCGTT
TGACGATTGGTGTGGAGCTTGCTGCTCAGCCGAGTGTGATTTTCCTGGATGAACCAACCAGTGGCCTTGACGCGCGTTCTGCCAAGATCATCATGGACGG
TGTCCGCAAGGTGGCGGATTCGGGCCGTACCATCATCTGTACGATCCACCAGCCGTCGGCTGAAGTGTTTTACCTGTTCGACAGACTGCTTCTGCTGCAG
CGCGGTGGCGAGACTGCGTTCTACGGCGACTTGGGCGAGAACTGCCGCAACTTGATCGACTACTTTGAGAACATCCCTGGTGTATCTCCGCTGCCGAAGG
GCTACAACCCAGCTACGTGGATGCTGGAGTGCATTGGTGCAGGTGTGGGTCATGGAAGTGAGGACTCGATGGATTTCGTGAGCTACTTCAAGAACAGCCC
GTACAACCAGCATCTGGAAACTACGATGGCCAAGGAAGGCATCATGACGCCGTCTCCAGACCTCCCAGAGATTGTCTTCGGCAAGAAACGTGCTGCCAAC
TCCATGACGCAGATGAAGTTCGTGGTGTGGCGCTTCTTCCAGATGTACTGGCGTACACCGAGCTACAACCTGACGCGGATGTACCTCGCCATCTTCTTGG
CGATTCTGTTCGGCCTCATCTTTGTGGGCAACAATGACTACGCGTCGTACTCCGGCTTGAACTCGGGCGTTGGCATGGTCTTCATGTCTGCGTTCTTCAA
CTCGATGGCCGTGTTCCAGAGCGTCATGCCATTGACGTGCATTGAACGCCAGTCGTTCTACCGTGAGCGAGCGTCCCAGACGTACAACGCGTTCTGGTAC
TTCATTGCCTCCACGCTGGCTGAAATCCCCTACTGCTTCGCCAGTTCGCTGCTCTTCACCGCCATCTTCTACTACTTCGTGGGCTTCACCGGCTTCGGGG
CGGCCGTGCTGTACTGGCTGGCAGCCTCGCTTCTCGTCCTCATGATGGTCTACCTGGGCCAGTTCTTCGCGTACGCCATGCCGTCAGAGGAAGTGGCGCA
GATCATCGGCATCCTGTTCAACTCGATTTTCATGATGTTCGTGGGCTTCAGCCCGCCAGCGTACGCCATCCCGTCGGGCTACACGTGGCTGTACGACATT
TGCTTTTTCAAGTTCCCCATTTCCATCCTCATCTCGCTGGTGTTCGCCGAGTGCGACGAGCTGCCGACGTGGGACGAGGCCACGCAGAGCTACCTCAACG
TGGGCTCGCAGCTTGGTTGCAAGCCGATGGTGGACTCTCCGGAGACTGTGGGCCACATCACCATCAAGGAGTACACGGAGGAGTATTTCGGCATGAAGCA
CAGCCAGATCGCGCGCAACTTCGGCATCACGATCGGCATCATCGTGCTGTTCCGCATCTGGGCCGCGCTGGCGCTGCGCTTTGTAAACCACCAGAAGAAG
TAACCTGG