Description :
From Genome Similarity Track
Location :
Scaffold_280:18081- 22408
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_280-snap-gene-0.18CCAAT-box DNA binding protein subunit B
Pytar_ATCC12531maker-par_contig_280-snap-gene-0.13GF13390

Sequence
4327 bases(100 bases per row)
TACTCTACATGAAGTTGAACGCCGAGCGCTCGGCAGTGGGCGCGTCGCCATTGCCAGGGTTGTTGCCGCTGCTGCGCGGCGAGTTGGCGATCGTGAACAA
GTCCTTGCCAAAGTTGCTCAGCATCGTCGACCGGTCACCGGCAGGAGCCTGGCGCTGTGGCGACTGCAGGAGGAGATCACCATACTGTTGCTGTTGCTGA
GGCTGCTGCTGCTGGTGTTGCTGGGGCGGTTGCTGGTGGTATGGCTGCGGCACGGGATCGAATCCGTCCAGTAGCTGCGAATTACGCAAGCAACGAATGA
GCCTCCAGTTATCAGCCACGACTCCTAGGAAGGGAAACACAACTTACCGAGACCTCCTGTGGCGGGGCTGGAGCCTGGCGAGCACTGGGAGGCGGTGAAT
TGTAGATATTGGGCGCGACCGGCGCTTGTTGTGGCGGTGCGTTGATTGAGAGCGAGTCGAAGCCTAAAAAGTCGACCTCCCCGCCGCCTCCGCCGCCGCC
ACTCGGTGCAGCAGGCGCGGATCGCGTGGGCGTCGAACGAGCGGCTGGTCGCTTGACGGGCTCGGGGGTGGATTCGTCGGCGAGCCCCAGCACACGCATG
ACCTGCAGTGCCTTCTGCGCGACTGTCGGCTTGGCGTCCTCTCGCAGCTACACAAGAAAGCGTTAATCGAGAGGAATTCTCGAGACATTCATGAGACGTT
GCTCTTACCTCTTCGAGCACACCGGCATTATCTTCAAAGATCTCCATGTATGGCGCAGCACCGGGGGACTCGAGCAGCGCGAGCACGACGTGGAGCGCCT
TCAGCCGCACTTGCCACACAGCATCCTCAAGCTTGTCGAGCAAGATATCGCCGATCGTCTGATGGTCGAGCGTCTGCGCGAGATCTACGAACCGCTTGAG
TGCATCTGCTGGCGGTGCCCGTGCTAATCCGACCGACGCACAGAGGCTGTCAATAAGACCACGTTCATACTCCCTATGAATAAATCGCAAAGAGATCCGT
CAGTCCGTGTGCCCAAATCTCTATATACGAAGGAGAAAACGTACCCGCTCGTATCCTTGCCACCCGTGACTTGCTGTGACTGCGGCTGATAATACCCGCG
GTCCATCACGGTCGGGCCGGCGTTCAGTTCGTCGTGGTCGGCCAGCGAGGCGCCGATCGACTTGTCCATGTTACGCCGGTCCCAACGGTCCTTGGCTTCG
ACACCAATCTTCTTGAGCCCGACGACGGCCTTGCCGATCTTCGTGGACGGCCCTGGACTAGCGCTCCCGTGCATGCCGCCGCCACCGCCGCTGAGCCCCA
TGCCGCCGGATGGATTGCTCAGCATTCGGTTCATGTTGTCAATGTACGACGGCGTCTGGCGGGACGCATTCCCACCAAAGCCTCCGCTATTGCCACCAAA
ACCTCCGCTGTTGCCACTGAAGCCTCCAGTGTTGCCTCCAAACCCACCGCTGTTGCCGCCAAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTAC
CGCCAAACGCACCGGTGTTTTGGCCACCGTAGCCGCCTCCACCACCGGACGGTCCGCCGTAGCCGCCCGAGGGGCCGCCATACGCGCCGCTGCTGGTGCC
ACTCACGCCGCCAATGAGACCGCTGTTCCCGTGGGACTCAGGCTTAGGAAAGTTGAGATTGTGACCAACGAGAACTGTCGGTCGGTTGTCGCGCGAGGGT
CCCCCACTCGAGTAGTTAGGTGGGGGAGGTGCAGCCTTCTGGTACCCAGAGCTGCTCCACATACCTCCGGGAGCAGCCTTGGGGGCGCCGTACGAAGGAA
CCGACGGCGCCGGGTTCGACCACGAACTGAGACCGCTCGGTTGATGCGACTGGTGTTGGTGCTGTTGGTGCTGCTGCTGATTCGCCTCGTGGCCATAGCC
TCCACCACCGTAGCCCGTGTTGTGCTGGTCATTGCCATGCTGAGGTCCGCCATAGCCGCCTGGCCCTCCATACGATGGGCCAGACGGACTATCTGAGTAT
GGGGCCGGTCGCGAGTCTCTTGACGAGTTGTTTCCCCACGGACCAGAGCTCTGGCCATCAGATCCATTGGACGCGCCATATCCGCCTTGTTGACCGTACG
CATTGGGCTGAGCTCCACCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCCACGGTCCTCCTCCCCCTCCATTCGCTG
GTGGTGGTGCATCATTGCGGCGGGGCAGACAGCCATCGTTCAGACACACGAGCACTTCCTGACACGCAACGCGGATGCGGCGATACCGCTCGTCACCCAT
GACGGGATCCGGCGGACCAGAGAACTCTGTAAACGCAACAACAAAGCGAGGCATTCCATCGATGATTAGTCTCGGGAATACGCCTCTCGGCAGTAGCATC
TCGACAGCTTCAACGTACGAATATATGCCGAGATCTCGCTTTCTTCTTCGCGCATGACCTCCGTGAAGACGGGGTCTCCTTCACGGATACAGAACTGAAT
AGGTATTGAGCATATAATCGTTAGTGGCTGGAAGAGCGCGTAGTGAGAGAGATAGAGGAGGATCCCGCACCGCGATGATCTGGAGCACTTTCAGCTTGAC
GATCAGGTTGGTCTTGGCGAGACGCCCGAGCAAGAAATCGACAGTCTTCTCGGCATCGCGTTCGCTTGCCTTGGTGCCATCTACCATACACGCAGCGATA
ATGAGTAAGATGAGCCCAACATGGCCGTGAAGGAGAGACACGTACTGGCGATCTCCTGCATGAGGTAGATGGGCACGGCAGCGTCATGGAGACTCGTGGC
ATCCGCCAGCGTCTGGCGGTTCATCGTGGAGATGCTTCTGTGGGCGTGGACAGAGGGGACTCTAAACTTGCGTGCGGGGGGTCGTCTTCCGTCTCCCTTC
TCCTGAGCGCACTTCGTCGGTCGCGGCGTGCGTGGGGGGATCGGCTCTGTCTCCTGAGGACCCGAACAGCGGCTTCCCTTTGGATGGGGCTCCTCACACA
AGTCGGTGACCTTACTATTCAAGCCAATTAGAATGGAGTCAGCCATTTATAGCCAATCAAAGACTGTCACTTTGCTGGCCGGAACCTCTGCAATCGAATG
CGTCCAGACTCTCGGCGCATTCGATAAGAGGGGTTCTAGGCTTCAGTTAAAACCGATTCTCCGCTCCCCCCAAGAAACGGGCACAGCCACCAGGAAGGTT
TTTGGAGGACGCGGTCATGGTCGGCAAACAGGGCAAGGGGCGGCGGCTGACCGACAAGGAGCGCATGGAGATCATCGCGCTCACGCGGCAGAACCCACGC
GTGAAACACGTCGAGCTCGCAGCCAAGTACAACGTCAATGAGTCGACCATCCGCAAGTGGCGCGGGCAGAGCAATGCGTCCAAGATCGAAGAGCGCTATG
CGCACGGCGTCGCCGCGTCACGGGACGGCCGCCAGCGTGGCCAGGCGGTCCGCAACGCGCAGTTCGACGCCGAGCTGTTCGAGTGGGTCGCTGCCACGAT
GAAGCAGGAGCAAGACCTCGCACCCGCGCGCGTACGCGAGAAGGCACGTGCGCTGGCCGCGCAGTACGATGGCATGGAAGGGTTCAAGGCGTCATCCGGC
TGGTTCTACCGCTTTTGTCGGCGGTACGGTCTTCCATGCGGACCTGCGAGCCGTGACACAGGCACAAAACCCCACGAAGAGGCGGCTGTANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGACGTGAGCACCCATGGTGCGGACGGTGCATTGGTGCAACAGCCAGCAGGTCATGCGATAACCCA
ACCACTCGAAGACGACCGAGTGGCTGCCAGTGCTAATAGCGCTGCCGCGATTGCCAGATCCCTCCAGCCACCTGCGGAGCCATCAGCAGCGGCAAACTCA
CCCGAAGCAAGCAAGGTGGAGCAGACAGCCCAGTCAGTTGAAGAAGGTGGTGTGGCTCCGCTAGCCTCGAGTGGAATGCTCCTCGGACTGGGCGACATGG
CGACTGCGCCAGCAGCAAACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAACAGGTTGTCTCGCCATCCAACGTCGCCAACATCAGCACCA
GCGCCGTGTCCACAACGACACCGCAAGCATTCTCCATGCCGCAGGCCGCGGCGACCCACATGGTTCACCACTTCAAGGACGTGCTGGATCCGCAGACGCG
GCTGCGGCTTGTGCGGCACTTTATGAGCGTTGCCGGCGAGGCGGAAATGTATCTGGTGATGGACGACGAGACGCGGCTCGAGTACGTCAAGGAGTTTGCG
GCCGCGCCCGGCGCCACGGACGCGCCG