Description :
From Genome Similarity Track
Location :
Scaffold_1081:1808- 3010
Transcript NameFunction/comments
Phypl_g12303conserved hypothetical protein

Sequence
1202 bases(100 bases per row)
ATGGCAGGGTTCCGGTGGATGTAAGGCAAGTTGCTCGGCAGAGTTTTGATCTGCATCCGAACGCCCTGCTCTTCGTCAATTGTCACGATGCGTGGCGCGG
GAAGGGAGCTGCCCGCCTCGGATGGAGGAGAGGCCCCGGGACCATCAGTGAGCAGTTTTGCCTCGACGCGCTTCGTGATCGCTGCTACTGACCGGACAGA
GTGCACGGACCGAATCGACTTGCACTCCGACAGCACGCTACTCGCGACACTcatggtgtcgtcgtccttggcaTCTGCACGGTCCCATCCAAGCCGAGAC
AGATCGTTCCCATTgagagcgccaccaccgttGGCTAGCtcttcgagtcgctgctgctcacgttcgTAGCGCTtttcctcggcctcctcgtaGTCCACAA
TGGACTGCACCTGTGCTAATTGCTGCTCTACCTGTGCCACACGTGCCTTgacctccacgtcgtccatgaACTGATCAATGTTCAGGTTGTTTGCAAACTC
AATGAGGTCGTTGGCTTCAGCATCCTCCAAattgtccagcttctcgtccgccGTGGCCTTCGTCAATGCCCACATGGGGCGGTtcaagctcttcttcttc
cccgCAGCAGGaccagcgtcagcgtctgcaccatcctcggcgtcgtcgttATTGCTGCGCACCGCCTCACGCATCTTGGCTTCTCTCTGTGAAAATCGCT
CTCGACGCTTTTGAGCaacgtcttcatcttccgcAAGCGCCTCCTGCAGTCGAGCACGCTCCGTCTGCAAGTCGTGGAGCCACTTCTTGTGCTTCGACAG
AGCTGTGCTCTTCTTGTCACGACGGATTGCATGCTGCGACTCAATCAAAGGTAGCAATCACCGTCAGAGGCCGTCAACAATAGTGTCTTCTACCACATTG
GAGCACAGCCCAAAACTCACCGCAGGCTCGCTCAGGATCGGCACGTTCAGTCCCAGAGGCTCACCAGGGTTGCCCGCCAGGAATGCCGCCTTGCTGTTGT
CGGCCGCATTGTTGTTCGGCTTGGCACCGTATCGGGTTTCCTTCGCCAACGCTGCACAAACAACATCACAAGGTCAGACACTAGGACTCCATTGTCCGTG
CTCGTCAACGACAGCCGCTTACTGCTGGAAACCCCGTTAAATGGCCGATTGCAGAGCATGACGCCCTTGTAGTTGCCGATGCTCACAGCTGCCGCCGTCA
TG