Description :
From Genome Similarity Track
Location :
Scaffold_1143:1808- 2871
Transcript NameFunction/comments
Phyag_g9658hypothetical protein PHYSODRAFT_511111

Sequence
1063 bases(100 bases per row)
gacgaggaagaagaagaagaagactaACCGCCATCAGAAAGAAGACGCGACTCGTCAATTGACGAGTTTGTTGCGGATCGAGAGCGACAAACTGAACGAA
CAGCTACTGATCGCGAGCGAAAAGGGCAAGCAACGCGCAGTCTTCCTGTTGTTGCACCAAGGAGTCGACAAGGACCGATGCCGGGGACTCGTAAGTGTCG
AATTTGATGGGGTAGACAATGATATCTCTAAGTATGGTTGAttccgttgctgttgcagcttgggTACTCTCCGATGCATCACGCAGCGGCTCGAGGACAT
TTGAATGTGCTCCAATTGCTGCTCGACTTCGGATGGGGTGTTGATGTCCGTAACGATGCTCTTGAAACCCCCCTCCACCTCGCCTGCTTCGACGGTCTTG
TCCACGTTGCGGAGTTCTTGCTGGATCGCGGTGCAGATATCAACGCGTGTACTGATGACCAAGAAACCCCGTTGTTCTACGCTGCACGAAAGGGTCAGTA
CCGAACAGTGCGTCTACTGGTTCGTCGGGAGTGTGACGCTGCTGTAAAGAATTGCTACGGAGacgttgctgaagaagaagctcgagacgccaagacgctg
gctGAGTTTGCGACTGCAACTGAAGACTTGCAACGAGCGTCGGCTGCAGATACTCAACGAGGGACAAGTTCCGAATGCGGAGAGCACGTTTTATCGCAAC
GACTACGTGAAAGAGTGCTGACGTTCTTGGACCTGAAAAGTTTGGGATACGCTTCGCAAGTGTCGTATCGGTGGCATCGAGCGGCGGATAATTCGTCGTT
GTGGAAGAAACTCGGCGTCTCTCGATGGGGGCTGCTACTCAATGCAACGATGGGAATGGGGACGGTGTCTCCGATGGCGATGATGGGGACTGCTACCAAC
AAACTGTTCCGCCTAAATCTTTCGTCGACAGTGAATCGACGACCATCTAGCTGTGATCAAGTCAGTCTCGCTAGACCGATGCCATTAAGTGCGAAGGTAA
GAGAACATCCGCGGCATCGAACAGAGTTACGACCGCGTACAGCAAACGTTGCAGGAATATAGA