Description :
From Genome Similarity Track
Location :
Scaffold_295:18077- 19190
Sequence
1113 bases(100 bases per row)
GGCCACATGCCCCTATACTCAGCTTAAGTCAAATCGAAAAAAAGTTTTGGTAATTTATATGTTTGGACACTTGGGGTGGCAACCAGAAGTTAGTTGAGAG
TTACGCGGCCATCCCGGAAAGACACCTTTTTGAACCCATCGATTTCCAGGGTCACCTGCAGTCTCGGGACTTGGTCGGAGGTTGTTAAGCATCACTTGGA
GCCCCTGTTCCCAACTCAACTCGGCGGGAAACGTCCTGGGGGTCGCTCGGGAGGGTCGTCAAAATGGGTACAAAACGCGGTTCGCGCGTTTTGGGGGTGT
TTTTGGGCGTTTGCGGGACTTTGCACACGCCGCATGGGACGGGGCACCCCCGGATTTTAGCTGAGCGTGTAGTACTCGTTACGGGAATGTGTTTAGAGCT
AAAGCCCACCTTCATACGATCTCTAGAAGCTCCGCTAGAAGAAAACCAGCTCCCTGGCAGAGCACTTAAAGTTGCCTTTTTGGCGTCTGAACTTGGGGAA
AATGCGATATCTCGACAACTACTGGGAGGTAGCTGCCCAAACTTCGTGGGCACTTGGCGGGGAGATAGTCCCAGGGGACCATGTTGGTGCGCCAGCTGGC
GCACCGCACATGGCACATAAAAGTGGTTTTTCGTGGTCTGAAACACGCATATTTAAGAATAAGCAATTTTCAGTATGCTATTTGAAGGTGTTCCAGAGGT
CGCACACACTTGTCAATACGATATTCGGAATCGGGAGGCAATTGTACGTCTAGATGGACCATTCCCACCGGACAATTCCATTGGTCAAAAATAAGTGTAT
TCAGTTTGAGAGGGTTCCAGAGAAGGTGCATATTTGGCAATACGATATTCGGACGCTGCGTACAAAAGAACGCCTAGATTTGGTCAAGTTACGATATTCG
CGACGTTGCGTACAAAAGAACGCCTAGATGGACCTTTTCCGGTCAAGTTCTACGCACCGTCCGAGTGCGCCAATGGACTCAGCGCATGAAACTACCCCTA
GCCACATGGTCGGGTTGCGTGTAACGACCGTCTATATCATACTTTAGTTCGCTCACATGTATTTCCTTAATAAAACCTATATTCAACATCGGTCAACTGA
GGTGGCCCACCTG