Description :
From Genome Similarity Track
Location :
Scaffold_17:180755- 183134
Sequence
2379 bases(100 bases per row)
GCATCTGCATGTTCCTTCTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGAGACTAAGTCATCGACTTGCT
TGCGAGCCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGGCGTCAGTGGGACGCGAGGGTT
AACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCAAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTT
GGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCA
AACGAGTGCCAAGCACTCTAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCTGTCTAAAA
ACAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAGATGAGTCATCTTGCTCAATCGGTCTACAAAGACCACTATACCTGTGTTTCC
CGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTAGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGC
GCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATTTTGGGCCACCAGTACATCGTGCTCACCGAGCCGTAGG
TCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTGAGATCCTCATCATGAGGAACGACTACACGAGGGTT
ATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTGGCGCGTAACCGCCCAGACAATTCTTTGTCAGAGTCTAGA
AACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCTGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGA
CATGGGCTAACTCGTAGTCCGGCCTGCGCGACAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAA
GGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGC
AGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAA
ACGCGATCACGCGTTCACGCCCTTTGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGG
GTCCGGTAGCGCAAGGATCGGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGCCCTTCTTA
AGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGATTGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCATTTTGGTTCT
TGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATAAAGCACCCGAGGAAAGGTATCTCCTCCGCGCC
AAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCG
TGCTCGGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTG
GTGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAA
TTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGCTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGG
ATAGTGGCCGCATTCAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCT
CACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTG