Description :
From Genome Similarity Track
Location :
Scaffold_252:18071- 19549
Sequence
1478 bases(100 bases per row)
TGCAATAGGTAAGGTATAGTGATCAAAATTCGAAGCCGCATCAATTAATGAAGTAATTCTATAAAACGTTCGATTGATATTTGCTACTTGAGAGTTCTTG
ATATTGATAATTTAACGAGGACACATCATTACAGCAACTTTACTCATAGTTTATGATACTACGTTTTCATTTTGCGCACTATGAAGCCTGTTATCGGACG
AACCAGATTACCATGTTTGTTGTAGAAACGGTTTAACCGTTTCTACCATTGTTCTTATCGGCACATGATTCAGAATTACGCGAATTTGAGCGATAGACAA
TATTGTCAGTCTCTGATTTTTTTTACCATAAAATCGTTTATATGAAGGTGCTGTCAATGTTTTTTTCATCACCCGGATACAGCATCGGAATGGTCAAGAT
ATGGCTTTGACGTCAGCTAATGTTGAGGGAAATGAATTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATAATCTGAAGGCGTTCTGGTTGATCCG
CTACGGACATATGCAAGCGGGATAAGGTGCGATGTCGACTTAAGCATAGTCTGTCGAAGTTATTTGTCATTTATTGTACAAATCGTTTCTTTATTGGTCT
AGTCCAGACGTTTTGGATTGACATCGTAAATATGTGAACCTGACATTTTCACATACTCTGGATTAGATACGATAATGCCGTCTTAAACGTACCTCGTGTC
CGAATTCATTGGCAAGTCATCACTAAACGAAAAAAAAGTGAGTGAATTTAACCAAAAAGAAAGTGAATTAACCAAAAAGAGAATTTACCAATTTCATATT
TTTATACGCTTTTTACTGCGTATCCCTTGCTGCCATTAGCAGCACCGATTAGGATCTAGCGGAACAGGTATTCAGCTTCCATACTGTTGTAGAAGATAAG
CATTGATCCGGAGCGAAGAATTTTACCCGTTTCACTATTATTCTCATTCTAGGTACCCTCAGCGCCTATGGTATTTTACCGTTTCACTATATTCTCATTA
TTTGGTACCCTCGACACATATGGAGGCAATCATGTGTATGAAGATCTGGCCGTTACGAAATATATGTATGGTAAAATATTCAATGATCTCGTCCCGCGGT
ATCCTGCGTCCCATCCTGTCCTGCGCAGGATAGAACGCAAATATGCCAATCCCGCCCCATCCCGCGCGGGATGAAGCCCTAGACAGGACTTCAAGGCCAC
AACTCTGCAATAATGAGAGCAAATACATACTAAAAATGGCAAGACGGTCACATGAAGGTTCGAATGGCGTTAAGAGTA