Description :
From Genome Similarity Track
Location :
Scaffold_2157:1807- 4430
Sequence
2623 bases(100 bases per row)
GGGGCAGCAGCATTCCATCCCAGCGAACACTAAAAGTCTCAGCGGAGTACGTCTGTGAAGGTGGCCGCTCACCAAAATCAAAACTGATAGTTGCATCGCG
CCGCTTTAGTACCATCAGCGAGTTATCGGATGAAGATTCAGCTGTAGCGATTCCCACAGGAAGTGCACTTGCGGCGTAGCACGAACCGTTTAAACCTCCC
GGCGTCATCAGTTTTGGTGTAAAGGGAAACAGTACACTTCTCCTCCAGTGTAGTGTGACCAGATAGCTCCCATTCTTTTCGTCAGCAATCTGCACGTCGA
GGAAAGCACGTACAGACTCATCCAATTTAAAAAGATTTCCACCAGTCTCCAGCACGTTTCCGACGGTGTCTCGCGTTGTGAATCTGGATGTAATCTGTGC
CCCCGCCCTAAAGACTAACGGTGGATCGACTTGCAACTTTGGCATCGCTGGAGAGAGTAGATCCAACTCAGTTGTCGTAAGCGACGTTACTGCCGTGTAC
GCGTATATCGTAAACGGGTTAGATACAACTGCCACATTATCCACGGTCATGCTGATCTTGTAGCTGCCATTCAGGATAAGCGTGTACGCTACAATAAAAA
TTCCGCCCCCCGTCGGCGTATGTCACTGTTACCGCAGCATCCATGGTGGTAGTAACTGCACCCGGGCCTGTAAAGGTAACGCTGATGCTTTCACTACCGG
CGTTGGACTTCGCATTCCCGAAGGCATCCAAAACTGACGGTAAAGTTTGTTCGAGGTCCAGCAATTGCCGAAACCAGGGCATCACCTGATGCTACACAGC
GTGATCCCAACGCTGGCCCAGCAGTGACATCCACAAGGAACGGACTTCCACTTATTGCTTGCTGAGATAGCGTCACATGCAGTCGTGTAGTGCCAACGCA
GTGCGCTGTTTATGTACAGGTATAGTGCCCGTTGAGTAAGTCAGTGCAAGCATTTCCGCTCACAGTGCATTTATAAGGGTGCGTGAACGCCACTGTGAAT
GCTGATACGACTCGGANAAAAGCATTAGTTCGAGTAATGCGAGTAAGCATGTTTTAAACGGTGGAAATCCTAGTAAATTTTGACTTGCTGGAGCTAATAA
GGTCCATCGGGGAGGTGATAGAGTAAATGGTTCCCCCCAGAAAACGATTATATAGCTGTTTTCTTCTCTGGTGAGCGGCTTGAGGAGCAGTGGATGCCGC
CCAAAACTGTCTTGCCAGACGATGCTGTTGCACCGCTTGCTCggggtgctgctgcacttgatgGTGTCTCCCGCGCTTTTGGCTCTAATTCGTTATCGTA
AAACGGAGTCTGTTCGAAACAACCGTCTTAAATGTAGTATTGGTTTATCCGTTTAGAGAGGTGGGCCTATGTACTGTCAGGTGCGAGTTCAGATGCTACT
GACGGCGCGAAGTGTTCGCCGTgtcgcgccgccgccgctttgCGTTTTTCCGATGACCGAGTCGTCGTTATGGATATGGAGGACCTAGCGCAAGCACTAG
CTAAGAGTCAATCGCTCGGCCTCGACATTACCGGCGTTCCCGAATAGAAGGCCCGCGAATTGCTTACTAAGCAGTTTACTCGTGCACCATTTTCATATAC
TTGTGCTTCATCTCTTCAGTCAAAATTTACTCGGATTTCCACCGTTTACAGTTATTAATAACAAGCTTACCTACTCGCATTCCAGCCTTACTCGAACTAA
ATCCGCACCCATTTGACTCCACCAGTGGGCATCGTTACCACAAGAATCCCGAGTTGTCACCTCGAAAGTAGTTTGCACATTGGTTTTCGCAGAAACTATG
GCGGGCCTTGGGCACTGCTTGTCGGCCCCGCAGGAGTGCTGGGCACGACGGTAATTGCATACGGACTGTTATGCAACTGAATACCTTTCCACGTGACTGA
AACCCTATAGCTCCCCACTACACGAGGAGTGTACGTGAACTTGTAAGTTCCATCAGCATTGTCGACAATTTGGCCCGTTACTACGGTTGGAACAATGCTC
GACGAGAGGAAGGCTTGAAGCTTAAGATCAGTTAGTCCTCCAGTGTAGATGCGGTTTGCGTACAGATCTCGCGTTTCAAGTGCCACGTTCACAGATTgcc
cagcgacgcgtccagcAAGTAAACCCGACCCAAAAAGCACACATCGGGCCGCGTTGGGCTGGGCTGGTACCACAGCTACTGTGAAAGGACTTGCTGCCAA
AGCAAAACTATTGATTTCCACGCTCATGGAATAGTCACCAGTACGCTGTGGTCTTGCCAGTACGCGAAACGTATCCAATCCTTCATTCCACGATACCAAT
GCATCCTCCGTCTTAGTACCCAGCCCTCCAAGACTTCGGTCTGTTGCCAACGTTAGCCTTGCAGCGATAACATCGCGCCGATTACCATGCTGCTCTCGCG
AACGCCGTCGATTACCGTATGCGTCACGCGGTAAAACACTAAAAACAAAAGTTTCACCGGCAATCACCCGAAGTACCGGAGATGTGGAGGATCCGTCGTT
CCTCAGAGTGGAGGCTGACAATTTGGTACTTGCCGTCAACGCTGGCGTCACAACAACATTGGTAAAGGGGGAATTCTGAATATGCGTGCCTGAAAAGAGT
CGCTGGGCTGGGATAACATCCAT