Description :
From Genome Similarity Track
Location :
Scaffold_544:18067- 21746
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_544-snap-gene-0.4Protein kinase

Sequence
3679 bases(100 bases per row)
CGGCTGGGAGCCGAAGTCAGCAGCAagCGGCGAGGACACACGAGGCGCGGACGGAGCCAAGTACCGGAAACACaCACTCTCCGATTCGCCGTCCCCAAGT
AAACCGCGACGACGAACGCTACTCTTTTCCTGGTCATGTCGGAGCCCATGGCGACGCTGCGTGTGGCTCCGGCTCGCGTCCCCTCGGCCACAACCACAGC
GCCAGCCACAACCACAGCCACAACCACAGCGCGTCGTCGCCGCGCCCGCCCGGGCTTCATCTTGGGCATGGACAGTCTTGCACTGGACGCCGTGCCATTC
GCAGCCACACCCAACGCGCAACTCTTCCGTGCGCGAGTAGTGGTCCCGGATGTGGACGGtATGGCGCCCGACActGTCGTCGTCGtcAAGCGGGCTCACC
TGGCGTTTGTGGACGACGCGGGCGGCTGTCGCACACAGACGTCGGACGACCCGATACGAGAGCTCcACGNNNNNNNNNNNNNNNNNNNNCAGCCACAGTT
GGGAAGGCTCATtACATGGCTCCGGAGATCGTGGCCAAGATGGCGTACGACCCCATCAAagCCGACGTCTGGTCGCTCGGCATTTTAtaCTTCATTCTGC
TCACGGGCTCGCCCTTAGTCAAGCTCGCGTCGGCTGGGGCCGGCGACTTCACGGCGTTCCAGATGCTCGGCAGCCGAGGCGTGCTGGAACTGTGGAAAAT
GGATGGACAGTTCTCGTTCGCCACACTGGATCTGCTGGACGGCATGTTACAAATCGATCCGCGAGATCGGTTCCAGAACATGTCGGAGGTGTTGGAGCAT
CCCGCGTTGCTAGCCGCTGCCGCTAGACGCCTCGCCGCCCAGGAGCAGAATGGAGCTCCCTAGAACATCACGACTTCATGTCGTAGTATCTAAATAGCGT
CGGTATTTCATGTTGGTACGAATACGAATAGTCTAATTGCTtGTGtGTCATCGTCTCGACAGCGTCCGTCATCACTGCCGTTCCGGCTgaCCAACGGCCT
CGTTCGTGGTCCACATGAACGACCGCCGCTGGCCAGCAAAGTTTCCCACCACACACTTCGCCCGACAGCACTCACCGGGTTCCGCCAGAAGACAGCCTAC
ACGCGTTTCTATGtgCGGCATGTCCTGTGGAAGAACTCCacAAAAAAGTCGAAGAAAGCAAAAGGAACGTGCACGAAGGGAaCAAGTTGTTCCCAATGGT
GCAGTTGTTCCGAACAACTTGACATGTTCGGGCCGCTTCGACGGTGTTCACCGAATTCGTGATGTCTTGATTGTGCAACTGTGGGACAACGTGTGCCTGC
TCCGTGTCTTTGTGCTCTGGTGACGACTCAAaTAaaaTTCCCgTTAAGTACGATATTCTGCTTCCCATTTGAGTCAGTGGCTTGAGAGTGGGTCCATGGC
TGAGTCAACACAGTCCCTGGACGGCCATGACCGTGGCGGGCCACTGTACAAAAACACTGCCATTGAACTGGATCAGGCTGGAAATGGTGTACAGCATGGA
atGTTGGAATCCAGCTGCGTCCACCTACACACTCGCCCTGGACACGTGTGTTTGTAACGTCCAAGTCGATCCAACGCCTTCGCCGTTCACAGTTGCTCAA
TGTtgCGGGTCTCTGCATGGGCTCTTGCTGGCTGTTTtCATAGGTCTTTCGACAAGTCTCACATGACTCTGCTGGTCCACTGACGGATGAGAGCTCTCGG
CATTGCTCGTGTTACTATCCACACACTcaGGCATCGGGTGCAGGTCCTGTACTCTTTCGaGCGAGTCGTGGCACTGGTCGCGTCACATCGCCCTCTCGTG
TCGCGTTCGTTCCTGATGGACGCCCGTTTCCGTGCTTTCACTTGTCCTTGTTGATGCAGTTCCGTtGGCTGACCCCATCGGCAGGCcGGAGCACCAACTA
ACGTCTTCTTAACGCGTTCAGCAGCCGGAGTCTTTCTATTGTGCCTCACCGTCATCTATCGTGCGCGATATTTATGCTCAGTGCGATTTCGATGCTACGA
CCGGGCTTCGTCTGCTTTCTCGGCGTCATTTTCATTCTGTAGCCGTCTCGTTGATCGTCTTACCAAGTTTcagCGCTGTTCCTCATGACgAAAGGCAGaG
gCAAAATGTTCGTACTTCTATTCCTGTCACCATTTACCTCCTTGTAACCATCGCAAAAGCGCGCTGAAGTCGGCACCTATAGCGCAAAATGAATTAGGCG
GGTTTGTCATAAAGCATATGCATCGGCCAATACGCAGAACTCACCGAAATGAGCAAGCGTCAGCTGCGGAATGATAaGCATCCAAAGAGAgAGTtGCaCT
GTGCCACCGTAAATTGAGTTTCCAGTACGAATGCAAGCTGATAAAaTGGCGAGAAATTTAGCCGATGTCTCAGCAGTAGCTGCAGTGCGAGAAGGGAAGC
AAACTCGAGTAGTGAGTAAATGGCAtAGTTGAAAAGCGTCCACATGAGCTGAGTTTGCGGTAGAGtagcTtCAtactcaTAGAATTGCAAGTTTGGCAAA
TGAAGAAGCACCGCCAAATATGCAGTGTACAATAGCGGCACTACGCACTCGACGTACTCAGCTAGGAGCAAGTATTCACACGAAAAAAGCAATCGAAGCG
ATTCGATCAACAGGCTGGAGGTATTCTGTCGTACTGGTGTTAGTGGAACACTTGAcGACATAGGCACAATTGCAACTCGTCGAGATGTGAAGCGTTGGGT
agAGGAGGTTGTCACTGAATAATAGATCCGCGTACGACGTGACAATATGGAGTAGCCGGGTATgagACTGTGGCTGTTGGTGGtcAgaCGACCCGAGAAC
GCGGACGCCTGAGAAGTCTAAGCTTCTCAGGGACTCGGTCCaGGTCAGATGATCGACTAAaGACCCcAGAAgtGTAGCTGAGTGTGTTCCTTCGCGCGAT
GTGTCCcGGAGTaGAGTATGCTCGATTTTTtGGAACGTTGTGTTTATCCGATGGACAGTTAGCaGCGTATAAACAACGTCGGCGCTAACGATCGCTGCAG
TCGCCAATGTGGAGTTGGCGTTTtGCATTGTTCGCACCatGTAGAGGGCGTTGAACACCTCAACAGTAAATATGGTAGTCTCCGGGATGAGATCTTCCCA
GTACCTAAATACCACAGCAGTGAGATTGCGCAGCAAGAGTCGAAGAAGTGGGTAACCAAGACAAAGGCCGTTTGCGCCCACTTGAAACGCGAAAGTGCGA
GGAAAATGGCATGACAAGTAGGATACCCcATCACAAGTACTCCAAGGATGACAATGAATCCACCAAACGATTTCGCGCGCTGCCGTAATTCCGGAATAGT
CCGCAGGCGCTTTATTCCAATGACTCCGGTAAATACGATCAAGAAGGTGCTACAGCACGGAAACGCGCTGATGACCACCATGAAAGGTACTGGGAAGCGC
CACAATGTAGCGAGCGTGAAGAGGTATCCAAGATAAAGCACCGTGGCAGCGGTGCAAGTAATTACCCAGTGATAGAGCTTCAGTGCGATTTCTGGAAGAA
CGTGTTAAGCAATTTGCATCATCGACATGTAGATCAAACACACAGTCCCCACTACGCGAAACCATAACATATAGTTGGACGAAATACCACTTTCTGGAGG
TTCTGGTCGGACGCTCTCAACTATCACCAAGAAAaGAAGCGATGGGAGAGGAAAGAGGCAGCAGACGACAAGCACGCGT